Skip to main content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
J Bacteriol. 2007 Mar; 189(5): 2046–2054.
Published online 2006 Dec 15. doi: 10.1128/JB.01375-06
PMCID: PMC1855743
PMID: 17172332

Identification of IspC, an 86-Kilodalton Protein Target of Humoral Immune Response to Infection with Listeria monocytogenes Serotype 4b, as a Novel Surface Autolysin▿

Linru Wang1,2 and Min Lin1,2,*
Author information Article notes Copyright and License information PMC Disclaimer

Abstract

We identified and biochemically characterized a novel surface-localized autolysin from Listeria monocytogenes serotype 4b, an 86-kDa protein consisting of 774 amino acids and known from our previous studies as the target (designated IspC) of the humoral immune response to listerial infection. Recombinant IspC, expressed in Escherichia coli, was purified and used to raise specific rabbit polyclonal antibodies for protein characterization. The native IspC was detected in all growth phases at a relatively stable low level during a 22-h in vitro culture, although its gene was transiently transcribed only in the early exponential growth phase. This and our previous findings suggest that IspC is upregulated in vivo during infection. The protein was unevenly distributed in clusters on the cell surface, as shown by immunofluorescence and immunogold electron microscopy. The recombinant IspC was capable of hydrolyzing not only the cell walls of the gram-positive bacterium Micrococcus lysodeikticus and the gram-negative bacterium E. coli but also that of the IspC-producing strain of L. monocytogenes serotype 4b, indicating that it was an autolysin. The IspC autolysin exhibited peptidoglycan hydrolase activity over a broad pH range of between 3 and 9, with a pH optimum of 7.5 to 9. Analysis of various truncated forms of IspC for cell wall-hydrolyzing or -binding activity has defined two separate functional domains: the N-terminal catalytic domain (amino acids [aa] 1 to 197) responsible for the hydrolytic activity and the C-terminal domain (aa 198 to 774) made up of seven GW modules responsible for anchoring the protein to the cell wall. In contrast to the full-length IspC, the N-terminal catalytic domain showed hydrolytic activity at acidic pHs, with a pH optimum of between 4 and 6 and negligible activity at alkaline pHs. This suggests that the cell wall binding domain may be of importance in modulating the activity of the N-terminal hydrolase domain. Elucidation of the biochemical properties of IspC may have provided new insights into its biological function(s) and its role in pathogenesis.

Listeria monocytogenes is a gram-positive, facultatively anaerobic, intracellular bacterium that causes a severe food-borne disease (listeriosis) with clinical symptoms including septicemia, meningitis, and abortion, mainly in immunocompromised individuals, neonates, the elderly, and pregnant women (52). The disease leads to a significant mortality rate of 20 to 30% (7, 18, 35, 46, 52). Although 13 serotypes of Listeria are recognized, serotypes 4b, 1/2a, and 1/2b of L. monocytogenes are responsible for almost all human cases of listeriosis (13, 34, 53), with serotype 4b strains accounting for almost all major outbreaks and a large portion of sporadic cases, suggesting that this serotype possesses a virulence potential highly specific to humans (15, 26).

Entry into host cells (professional or nonprofessional phagocytes) by L. monocytogenes followed by the spread of the bacterium into adjacent cells is a complex process in which a number of protein factors are involved (8, 15; reviewed in reference 52). Internalization of the bacterium by induced phatocytosis is mediated by the interactions of the specific cell receptors with at least two internalins, InlA and InlB (6, 14, 16, 37). Escape from the primary phagosome to the cytosol requires the lysis of the membrane by the pore-forming toxin listeriolysin O and a phosphatidylinositol-specific phospholipase C, PlcA (17). The bacterial surface protein ActA recruits host cell actin molecules and actin-binding proteins to form a comet-like actin polymer tail which promotes the bacterial intra- and intercellular movement (41). Listeriolysin O and a phosphocholine-specific phospholipase C with a broad range of substrate specificity, PlcB, mediate the disruption of a double-membrane phagosome in a newly infected cell (50). Other factors that contribute to the bacterial virulence have been demonstrated, including several autolysins (9, 22, 23, 27, 29, 38, 54), p60, Ami, NamA, and Auto.

Our group has been interested in immunogenic surface proteins (Isp) of L. monocytogenes, which are less characterized and understood. Study of such proteins may provide new insights into the mechanism of Listeria pathogenesis, virulence, and immunity. Recently, we performed a differential immunoscreening of an L. monocytogenes serotype 4b genomic expression library to identify genes coding for proteins that reacted with serum antibodies (RαL) from rabbits infected with live L. monocytogenes serotype 4b but not with antibodies (RαK) from animals immunized with heat-killed bacteria (56; W. L. Yu, H. Dan, and M. Lin, submitted for publication). That study led to the identification of eight L. monocytogenes proteins as targets of humoral immune response to listerial infection: three internalins (InlA, InlD, and InlC2) and five novel proteins of unknown function (designated IspA, IspB, IspC, IspD, and IspE). Proteins highly homologous to some of these novel proteins have not been characterized for Listeria. Demonstration of humoral immune responses to these proteins found only in actively infected rabbits and not in animals receiving heat-killed L. monocytogenes suggests that they are induced or significantly upregulated only in vivo during infection and thus are likely important in Listeria pathogenesis. In fact, InlA is a known virulence factor (16). Among these novel proteins of unknown function, IspC is a putative peptidoglycan hydrolase that is likely surface localized, as predicted from its deduced amino acid sequence (56; Yu et al., submitted; H. Dan and M. Lin, unpublished data). This protein contains 774 amino acids with a deduced molecular mass of 86 kDa and a theoretical pI of 9.4. Sequence characteristics of IspC include (i) a predicted 29-amino-acid N-terminal signal peptide; (ii) an N-terminal region (amino acids [aa] 58 to 197) sharing significant homology (35% identity) to the muramidase domain in the C-terminal region (aa 151 to 316) of the flagellar protein FlgJ of Salmonella enterica serovar Typhimurium (40); and (iii) a putative C-terminal cell wall binding domain (aa 198 to 754) made up of seven GW modules of 81 to 82 amino acids each containing a glycine-tryptophan dipeptide, which is similarly found in the C-terminal region of L. monocytogenes InlB (5), Ami (38), and Auto (9). The previous findings have prompted us to further investigate the expression of IspC in in vitro growth, its localization, and the functionality of its predicted domains, as reported in this study. The experimental results showed that the immunogenic protein IspC is a cell surface protein with autolytic (peptidoglycan hydrolase) activity and cell wall binding activity attributed, respectively, to its N- and C-terminal regions. These properties of IspC, together with current evidence supporting its upregulation in vivo during infection, suggest that it may play a role in bacterial pathogenesis, as was similarly found with other Listeria autolysins such as Ami (38) and Auto (9).

MATERIALS AND METHODS

Bacterial strains and growth conditions.

L. monocytogenes LI0521 (serotype 4b) and four Escherichia coli strains [DH5α, BL21(DE3), BL21(DE3)/pLysS, and ATCC 25922] were used in this study. L. monocytogenes was cultured in Luria-Bertani (LB) broth containing 50 mM MOPS (morpholinepropanesulfonic acid) (pH 7.5) (LBMOPS) at 37°C, and E. coli ATCC 25922 was grown in LB broth as described previously (31). For molecular cloning experiments, transformants of E. coli strains [DH5α, BL21(DE3), and BL21(DE3)/pLysS] were grown on LB agar or in LB broth supplemented as required with kanamycin (30 μg/ml in broth and 50 μg/ml in agar medium) or with kanamycin (as above) plus chloramphenicol (20 μg/ml in broth and 34 μg/ml in agar medium). Bacterial growth and cell number were determined by measuring the optical density at 590 nm (OD590) for E. coli and the OD620 for L. monocytogenes (31).

Generation of expression constructs.

All DNA manipulations were essentially performed according to established procedures (45). L. monocytogenes serotype 4b genomic DNA was prepared from 40 ml of overnight culture by using a GenomicPrep cells and tissue isolation kit (Amersham Biosciences, Baie d'Urfe, Quebec, Canada) as per the manufacturer's instructions. The ispC open reading frame was amplified from the serotype 4b genomic DNA by PCR with the primers listed in Table ​Table11 and Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA) and then was cloned into pET30a (Novagen, Madison, Wis.), which had been precut with NdeI and XhoI and blunt ended with Klenow fragment. The resultant construct was designated pIspC. The constructs pEAD1, pEAD2, and pEAD3, coding (Fig. ​(Fig.1a)1a) for putative N-terminal catalytic domains (EAD1 [aa 58 to 197], EAD2 [aa 58 to 263], and EAD3 [aa 1 to 197], respectively) of IspC, were similarly generated by cloning into pET30a the coding sequences derived from pIspC by PCR with gene-specific primers (Table ​(Table1).1). The constructs pGFPuv-CBD1, pGFPuv-CBD2, pGFPuv-CBD3, and pGFPuv-CBD4, coding for putative cell wall binding domains (CBD1 [aa 198 to 774], CBD2 [aa 234 to 774], CBD3 [aa 249 to 774], and CBD4 [aa 264 to 774], respectively) of IspC (Fig. ​(Fig.1a)1a) fused to the C terminus of GFPuv, were generated using a two-step PCR strategy (30). The CBD and GFPuv coding sequences were first derived from pIspC and pGFPuv (Clontech, Palo Alto, CA), respectively, and then pieced together by PCR with gene-specific primers (Table ​(Table1).1). The fused DNA fragments and the GFPuv coding sequence derived from pGFPuv by PCR with the primers P455 and P456 (Table ​(Table1)1) were blunt-end cloned into the NdeI and XhoI sites of pET30a to produce the fusion constructs and pETGFPuv.

An external file that holds a picture, illustration, etc. Object name is zjb0050765450001.jpg

IspC and its deletion variants. (a) Polypeptides encoded by the expression constructs described in Materials and Methods. IspC, aa 1 to 774; EAD1, aa 58 to 197; EAD2, aa 58 to 263; EAD3, aa 1 to 197; CBD1, aa 198 to 774; CBD2, aa 234 to 774; CBD3, aa 249 to 774; CBD4, aa 264 to 774. (b to d) The purified recombinant IspC (1 μg) was analyzed by Western blotting, with probing with anti-His MAb at 0.1 μg/ml (b) and with rabbit antisera RαL (c) and RαK (d) at a dilution of 1:1,000. Protein standards (Std) with their molecular masses in kilodaltons are shown on the left of the blots. The arrow indicates the position of purified recombinant IspC.

TABLE 1.

Various expression constructs and primers used in the study

Plasmid construct or RT-PCR targetPrimers used
Annealing site (nucleotides)c
Name (directiona)Sequence (5′ to 3′)b
Plasmid constructs
    pIspCP398 (F)TGATAAATAAAAAGTGGATGA2-22
P399 (R)GTTTAACGTTTGTAAAAGCTC2303-2322
    pETGFPuvP455 (F)TGAGTAAAGGAGAAGAAC(2-19)
P456 (R)GTTTGTAGAGCTCATCCATG(696-714)
    pCBD1P455 (F)TGAGTAAAGGAGAAGAAC(2-19)
P457 (R)CATATTTGGCTTTGTAGAGCTCATCCATG(696-714)
P458 (F)GCTCTACAAAGCCAAATATGATGTTTTATACG592-613
P399 (R)GTTTAACGTTTGTAAAAGCTC2303-2322
    pCBD2P455 (F)TGAGTAAAGGAGAAGAAC(2-19)
P459 (R)CTCCTTTTACTTTGTAGAGCTCATCCATG(696-714)
P460 (F)GCTCTACAAAGTAAAAGGAGTGCAATCTG700-718
P399 (R)GTTTAACGTTTGTAAAAGCTC2303-2322
    pCBD3P455 (F)TGAGTAAAGGAGAAGAAC(2-19)
P461 (R)CGATATCCTTTTTGTAGAGCTCATCCATG(696-714)
P462 (F)GCTCTACAAAAAGGATATCGATTTAGTATCTG745-766
P399 (R)GTTTAACGTTTGTAAAAGCTC2303-2322
    pCBD4P455 (F)TGAGTAAAGGAGAAGAAC(2-19)
P463 (R)ATTGATAGTATTTGTAGAGCTCATCCATG(696-714)
P464 (F)GCTCTACAAATACTATCAATTTAAATATAATGG790-812
P399 (R)GTTTAACGTTTGTAAAAGCTC2303-2322
    pEAD1P465 (F)TGATAGCACCTGCTGCCCAG172-189
P466 (R)GTAAATCATAATTCTCAATTAC571-591
    pEAD2P465 (F)TGATAGCACCTGCTGCCCAG172-189
P467 (R)GCGTACCTCTCTTTGTTG773-789
    pEAD3P398 (F)TGATAAATAAAAAGTGGATGA2-22
P466 (R)GTAAATCATAATTCTCAATTAC571-591
RT-PCR targets
    16S rRNAP394 (F)TTAGCTAGTTGGTAGGGT
P395 (R)AATCCGGACAACGCTTGC
    ispC mRNAP304 (F)GATGGTAAAGTCATTGGCTG1786-1805
P285 (R)TTAGCCTCGCGTATCAACTG2218-2237
aF, forward primer; R, reverse primer.
bAdditional nucleotides have been included at the 5′ ends of several primers to generate GFPuv fusions by overlap PCR (underlined nucleotides) or to ensure in-frame cloning (boldface and underlined nucleotides) into the NdeI and XhoI sites of pET30a.
cNumbers refer to the sequence position of the ispC ORF (Yu et al., submitted), whose first nucleotide is numbered 1. Numbers in parentheses refer to the sequence position of the GFPuv ORF (GenBank accession no. U62636), whose first nucleotide is numbered 1.

Recombinant constructs were propagated in E. coli DH5α. The presence of correct inserts in the plasmid vector was verified by colony PCR as described previously (Yu et al., submitted) with a gene specific primer (Table ​(Table1)1) and the T7 terminator primer (5′-GCTAGTTATTGCTCAGCGG-3′) followed by DNA sequencing. All recombinant polypeptides, which contain a C-terminal six-histidine tag, were produced in E. coli BL21(DE3)/pLysS (IspC and EADs) or BL21(DE3) (GFPuv-CBD fusions and GFPuv).

Recombinant protein expression and purification.

Overnight cultures of E. coli BL21(DE3) or BL21(DE3)/pLysS harboring one of the above-described expression constructs were diluted 1:100 into 2 to 4 liters of LB broth and subcultured at 37°C until the cell growth reached an OD590 of 0.6 ± 0.1. For IspC and EADs, IPTG (isopropyl-β-d-thiogalactopyranoside) (1 mM) was added to induce expression at 37°C for 3 h. For induced expression of GFPuv-CBD fusions after addition of 1 mM IPTG, the culture was incubated at room temperature for 4 h and then at 4°C overnight. The cells were harvested by centrifugation at 16,900 × g at 4°C for 10 min and frozen at −80°C until use.

For protein purification, the cell pellets were resuspended in phosphate-buffered saline (PBS) (pH 7.2) containing 1 mM phenylmethylsulfonyl fluoride and lysed by passage through a French press at 1500 lb/in2. The homogenates were spun at 27,000 × g at 4°C to collect the soluble form of the recombinant proteins. The proteins were applied under the native conditions at 1 ml/min to a column (1 by 1.5 cm) of Ni-nitrilotriacetic acid superflow (QIAGEN, Santa Clarita, CA), washed, and eluted using the following modifications to the manufacturer's procedure: binding and washing buffer: 50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0; elution buffer: 25 mM NaH2PO4, 250 mM imidazole, pH 8.0. Protein concentrations were determined by using the Bradford method (4) with bovine serum albumin as a standard.

Production of polyclonal anti-IspC antibody.

After collection of preimmune sera, two New Zealand female rabbits at the age of 2 to 3 months were immunized intramuscularly with the purified IspC (∼100 μg) emulsified with an equal volume of complete Freund's adjuvant on day 0. Booster injections with the same immunogen (∼50 μg per rabbit) emulsified in incomplete Freund's adjuvant were subcutaneously administered on days 14 and 28. Two weeks after the final injection, both animals were sacrificed to obtain a maximal volume of blood through cardiac puncture. Following removal of the clotted blood cells by centrifugation, anti-IspC immune sera (designated RαIspC) were collected and stored at −20°C until use.

SDS-PAGE and Western blotting.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described by Laemmli (28), using a 4% stacking gel and a 12% resolving gel in a Bio-Rad minigel apparatus (Bio-Rad, Mississauga, Ontario, Canada). Following electrophoresis, the separated proteins were either stained with Coomassie blue or electrotransferred onto a nitrocellulose membrane by using a Trans-Blot SD semidry transfer cell (Bio-Rad, Mississauga, Ontario, Canada) according to the manufacturer's instructions. The Western blot procedure for analysis of the target proteins with specific primary antibodies followed by horseradish peroxidase-conjugated goat anti-mouse or -rabbit immunoglobulin G (IgG) (Jackson ImmunoResearch Laboratories, West Grove, Pa.) was performed essentially as described previously (31).

TCA precipitation of proteins.

Proteins were recovered by trichloroacetic acid (TCA) precipitation from the culture supernatant of L. monocytogenes grown overnight in LBMOPS broth for analysis of the presence of IspC. To each 1.2 ml of the chilled supernatant, bovine serum albumin (20 μg, heat treated at 100°C for 5 min) and ice-cold TCA (250 μl, 100% [wt/vol]) were added, and the supernatant was incubated on ice for 4 h. The precipitated proteins from 4.8 ml of the culture supernatant were collected by centrifugation at room temperature at 14,100 ×g for 10 min, washed with ice-cold acetone (500 μl), and air dried. The protein pellets were dissolved in 60 μl of 2× SDS-PAGE sample buffer and subjected to Western blot analysis, with probing with RαIspC.

Renaturing SDS-PAGE analysis.

Full-length IspC or its putative catalytic domains were analyzed for the peptidoglycan hydrolase activity by using a renaturing SDS-PAGE procedure modified from that described by Potvin et al. (44). Briefly, the purified proteins were electrophoretically separated on 12% SDS-polyacrylamide gels containing one of the following autoclaved, lyophilized bacteria: 0.2% (wt/vol) Micrococcus lysodeikticus ATCC 4698 (Sigma Chemical Co., St. Louis, MO), 0.2% (wt/vol) E. coli ATCC 25922, or 0.1% (wt/vol) L. monocytogenes serotype 4b. Following electrophoresis, gels were rinsed with deionized H2O and incubated in a renaturing buffer at room temperature for 16 to 48 h with gentle shaking. For routine analysis, IspC was renatured in gels with 25 mM Tris-HCl (pH 7.5) containing 1% (vol/vol) Triton X-100. To determine the pH optimum for the hydrolytic activities of IspC or its EADs, various renaturing buffers (50 mM sodium citrate-citric acid buffer, 1% Triton X-100, pH 3 to 6; 10 mM Tris-HCl, 1% Triton X-100, pH 7.5 to 9.0; and 50 mM glycine-NaOH buffer, 1% Triton X-100, pH 10) were used. After renaturing, the gels were rinsed with deionized H2O, stained with 0.1% (wt/vol) methylene blue (Fisher Scientific, Ottawa, Ontario, Canada) in 0.01% (wt/vol) KOH for 1 h at room temperature with gentle shaking, and destained with deionized H2O. The appearance of clear bands on a blue background gel indicates hydrolytic activity.

Detection of IspC expression in cultured L. monocytogenes.

Expression of ispC in L. monocytogenes was analyzed during in vitro growth over a 22-h time course, at the transcriptional level by reverse transcription-PCR (RT-PCR) and at translational level by Western blotting. An overnight culture of L. monocytogenes was subcultured at a dilution of 1:100 in 2 liters of LBMOPS at 37°C. Bacterial samples (total RNA extraction, 4 ml; total cell protein preparation, a volume containing cells equivalent to 50 ml of culture with an OD620 of 0.5) were harvested by centrifugation at different time points of the growth curve (i.e., different OD620 values) and stored at −80°C until use. Total RNA was isolated from each frozen sample by using a RNeasy minikit (QIAGEN) according to the supplier's protocol for the isolation of total RNA from bacteria. Prior to RT-PCR, RNA samples were treated with RQ1 RNase-free DNase (Promega, Madison, WI) as per the manufacturer's instructions. cDNA, synthesized from ∼100 ng RNA by reverse transcription with random hexamers and a ThermoScript RT-PCR system (Invitrogen), was used for PCR detection of the ispC transcript in each sample with gene-specific primers P285 and P304 (Table ​(Table1).1). DNase-treated RNA before the RT step was analyzed by PCR as a control to ensure that there was no genomic DNA contamination. The level of 16S rRNA in each RNA sample, as determined by RT-PCR with primers P394 and P395 (Table ​(Table1),1), was used as an internal control. For Western blot analysis of IspC, frozen cells of each sample were resuspended in 1 ml of extraction buffer (62.5 mM Tris-HCl [pH 6.8], 2% SDS, 1 mM phenylmethylsulfonyl fluoride), sonicated 10 times on ice for 30 s each with 1-min intervals, mixed with an equal volume of 2× SDS-PAGE sample buffer, and boiled for 10 min. After removal of cell debris by centrifugation, the supernatant was analyzed by Western blotting, with probing with RαIspC.

Immunofluorescence and immunogold electron microscopy.

Localization of IspC in L. monocytogenes was undertaken with immunofluorescence and immunogold labeling electron microscopy essentially as described previously (31). Live bacterial cells from the early exponential growth phase were probed with RαIspC at a 1:500 dilution, followed by interaction with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (ICN Biomedicals, Costa Mesa, CA) at a 1:500 dilution for fluorescence microscopy on a Leica DMRXA digital microscope (Leica Microsystems, Richmond Hill, Ontario, Canada) or with 12-nm colloidal gold-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories) at 1:30 dilution for electron microscopy on a Hitachi H-7000 transmission electron microscope. Rabbit preimmune serum was used at the same dilution as a negative control.

Cell wall binding domain analysis.

Binding of GFPuv-CBDs to the cell wall (surface) of L. monocytogenes was investigated by using a modification of the method of Loessner et al. (33). Briefly, live bacteria (6 × 108 cells) were harvested from the late exponential growth phase by centrifugation, washed twice with PBS (pH 8.0) containing 0.01% Tween 20 (PBS-T), and resuspended in 1 ml PBS-T. Purified GFPuv-CBD fusion proteins were normalized by measurement of fluorescence at 512 nm with excitation at 396 nm on a LS50B luminescence spectrometer (Perkin-Elmer, Montreal, Quebec, Canada), using purified GFPuv as a standard. GFPuv-CBD fusions and GFPuv (control), each at an equal molar concentration (0.564 nM), were added into 100 μl of the above-described cell suspension, incubated for 5 min at room temperature, washed three times with PBS-T, and resuspended in 250 μl of PBS. Fluorescence images of bacterial cells complexed with GFPuv-CBD fusions were viewed and captured as described above.

RESULTS

Expression, purification, and immunogenic characteristics of the IspC protein.

Expression of IspC in E. coli BL21(DE3)/pLysS cells containing pIspC was demonstrated by the appearance of a protein band (Fig. ​(Fig.1b)1b) that was recognized by anti-His monoclonal antibody (MAb) (QIAGEN) and had migrated to a position close to the calculated IspC molecular mass of 86 kDa. The recombinant protein rIspC was purified to near electrophoretic homogeneity (Fig. ​(Fig.2,2, lane CB) and used to successfully raise polyclonal antibodies against the protein in rabbits (RαIspC), which were required for this and future studies for protein characterization. The purified IspC reacted only with rabbit antiserum RαL (Fig. ​(Fig.1c)1c) and not with rabbit antiserum RαK (Fig. ​(Fig.1d).1d). This immunological property is consistent with the recent identification of ispC as one of several genes coding for proteins reactive exclusively to RαL by differential immunoscreening of a L. monocytogenes serotype 4b genomic expression library (Yu et al., submitted).

An external file that holds a picture, illustration, etc. Object name is zjb0050765450002.jpg

Analysis of the peptidoglycan hydrolase activity of IspC by renaturing SDS-PAGE. The purified recombinant IspC (1.5 μg) was resolved on 12% gels containing 0.2% (wt/vol) autoclaved M. lysodeikticus ATCC 4698 (ML), 0.2% (wt/vol) autoclaved E. coli ATCC 25922 (EC), and 0.1% (wt/vol) autoclaved L. monocytogenes serotype 4b (LM) or on gels containing no bacteria (CB and WB). Hydrolysis of the peptidoglycan substrates occurred in 25 mM Tris-HCl (pH 7.5) containing 1% Triton X-100. ML, EC, and LM, peptidoglycan hydrolase activity staining; CB, Coomassie blue staining; WB, Western blot probed with anti-His MAb. The hydrolyase activity bands corresponding to the IspC protein band are indicated by an arrow.

Peptidoglycan hydrolase activity of IspC.

IspC was assessed for its peptidoglycan hydrolysis activity by renaturing SDS-PAGE analysis of the purified rIspC, using cell wall substrates from several bacteria. Hydrolysis of M. lysodeikticus ATCC 4698, E. coli ATCC 25922, or L. monocytogenes serotype 4b present in the renaturing gel resulted in clear bands corresponding to the position to which IspC had migrated on SDS-PAGE and Western blotting (Fig. ​(Fig.2).2). The recombinant IspC is capable of hydrolyzing not only the cell walls of the gram-positive bacterium M. lysodeikticus and the gram-negative bacterium E. coli but also that of the IspC-producing strain of L. monocytogenes serotype 4b. These results indicate that IspC is an autolysin.

Expression of IspC in in vitro-cultured L. monocytogenes.

The reaction of IspC with RαL but not with RαK, as demonstrated previously (Yu et al., submitted) and here, suggested that IspC either was not expressed or was expressed at a low level during in vitro growth. In order to differentiate these possibilities, the expression of ispC was monitored at both the transcriptional and translational levels over a 22-h growth period (Fig. ​(Fig.3).3). RT-PCR revealed that the ispC gene was transiently transcribed in the early exponential growth phase (Fig. ​(Fig.3b).3b). Surprisingly, the authentic IspC protein, similar in molecular mass to rIspC, was detected on Western blots probed with RαIspC in all growth phases (Fig. ​(Fig.3e).3e). Although the IspC protein exhibited a relatively stable level during the 22-h growth period, it appeared to reach a peak level at 4.6 h, in good agreement with that of the transcript (Fig. ​(Fig.3b).3b). The absence of the ispC transcript after the mid-exponential growth phase indicated that the protein was not actively expressed in later growth phases and that the protein detected in these growth phases most likely represented the undegraded protein synthesized earlier.

An external file that holds a picture, illustration, etc. Object name is zjb0050765450003.jpg

Expression of the ispC gene in in vitro-cultured L. monocytogenes. The bacterial samples were taken at various time points (i.e., different OD620 values) over a 22-h growth period and analyzed for the ispC transcript by RT-PCR and for the protein by Western blotting, with probing with RαIspC at a dilution of 1:1,000. The RT-PCR products shown in each lane (i.e., at each time point) were derived from the same amount of total RNA (∼100 ng). For Western blot analysis, the whole-cell proteins from cells equivalent to 0.5 ml of culture at an OD620 of 0.5 at each time point and the purified rIspC (1 μg) were used. (a) PCR analysis of the ispC DNA without the reverse transcriptase step; (b) RT-PCR detection of the ispC mRNA; (c) PCR analysis of the 16S rRNA gene without the reverse transcriptase step; (d) RT-PCR detection of 16S rRNA as an internal control; (e) Western blot analysis of L. monocytogenes proteins and rIspC with the RαIspC antiserum.

Localization of the IspC protein.

The immunogenicity and sequence characteristics of IspC suggested that IspC was surface localized. To demonstrate this experimentally, live L. monocytogenes was probed with the RαIspC antiserum, followed by immunofluorescence staining. IspC was detected by immunofluorescence microscopy, distributed unevenly in clusters on the cell surface (Fig. ​(Fig.4a).4a). Preimmune serum showed no fluorescence staining on the cell surface (Fig. ​(Fig.4c),4c), indicating the specific binding of RαIspC to the protein. These results were further confirmed by immunogold labeling of the bacterial cells with RαIspC (Fig. ​(Fig.5a)5a) but not with preimmune serum (Fig. ​(Fig.5b).5b). In addition, Western blot analysis of total TCA-precipitated proteins from the culture supernatant failed to detect any protein bands with RαIspC (data not shown). Collectively, these data indicate that IspC is localized exclusively on the bacterial surface.

An external file that holds a picture, illustration, etc. Object name is zjb0050765450004.jpg

Localization of IspC on the cell surface of L. monocytogenes serotype 4b by immunofluorescence staining. Bacterial cells (3 × 108) were probed with the RαIspC antiserum (a) or preimmume serum (c), followed by reaction with FITC-conjugated goat anti-rabbit antibody, as described in Materials and Methods. Cells were visualized with a fluorescence microscope. Fluorescence images (a and c) and phase-contrast images (b and d) of the bacterial cells in the same field are shown.

An external file that holds a picture, illustration, etc. Object name is zjb0050765450005.jpg

Localization of IspC on the cell surface of L. monocytogenes serotype 4b by immunogold labeling. Bacterial cells (3 × 108) were probed with the RαIspC antiserum (a) or preimmume serum (b), followed by interaction with gold (12 nm)-conjugated goat anti-rabbit IgG (heavy plus light chains), as described in Materials and Methods. Bacterial cells were visualized with a transmission electron microscope at a magnification of ×30,000, showing gold particles on the surface. Bar, 0.6 μm.

Cell wall binding domain analysis.

Four C-terminal fragments, CBD1 (aa 198 to 774), CBD2 (aa 234 to 774), CBD3 (aa 249 to 774), and CBD4 (aa 264 to 774), were produced in fusion with the green fluorescent protein variant GFPuv (Fig. ​(Fig.1a)1a) to define the cell wall binding domain responsible for anchoring IspC to the surface. The C-terminal region (aa 198 to 774) was targeted for fusion protein constructions because it contains several GW modules, which are similarly found in the cell wall binding domains of other L. monocytogenes proteins, such as InlB and Ami. All four GFPuv fusions evenly bound to the cell surface of L. monocytogenes serotype 4b as revealed by fluorescence microscopy (Fig. ​(Fig.6).6). However, the four hybrid proteins were different in binding affinity for the cell surface. Under the same assay conditions, only the fluorescence emitted from GFPuv-CBD1 bound to the cell surface was detected with an exposure time of as short as 0.5 s. Binding of CBD2 and CBD3 to the surface was detected at a longer exposure time (1.5 s). Detection of CBD4 binding required an extended exposure time of 3.5 s. A longer exposure time required for detection indicates a smaller number of fusion proteins on the surface. Binding of the CBDs to the bacterial surface is specific, as the interaction of the purified GFPuv with the cell surface was not detected at an exposure time of 3.5 s.

An external file that holds a picture, illustration, etc. Object name is zjb0050765450006.jpg

Binding of the IspC C-terminal regions fused with GFPuv to the cell surface of L. monocytogenes serotype 4b. Live L. monocytogenes (6 × 108 cells), harvested from the late exponential growth phase, was incubated with GFPuv-CBD fusions or GFPuv, each at 0.564 nM, at room temperature for 5 min and imaged with a fluorescence microscope (left panels). The C-terminal regions of IspC are CBD1 (aa 198 to 774), CBD2 (aa 234 to 774), CBD3 (aa 249 to 774), and CBD4 (aa 264 to 774). The exposure times for capturing images are indicted by numbers in parentheses. The right panels show corresponding phase-contrast images of the bacterial cells in the same field.

Effect of pH on the peptidoglycan hydrolase activity of IspC.

The effect of pH on the IspC hydrolase activity was investigated at various pHs of from 3 to 10 by renaturing SDS-PAGE analysis (Fig. ​(Fig.7).7). IspC is capable of hydrolyzing peptidoglycan at a wide range of pHs from 3 to 9, with a broad pH optimum from 7.5 to 9.0. Very weak activity was detected at pH 10. Interestingly, IspC exhibited a second pH optimum at around 4.0, with less hydrolytic activity than that at the alkaline pH optimum.

An external file that holds a picture, illustration, etc. Object name is zjb0050765450007.jpg

Peptidoglycan hydrolase activity of the full-length recombinant IspC as a function of pH. Renaturing SDS-PAGE was performed using M. lysodeikticus ATCC 4698 substrate (0.2% wt/vol) as described in the legend to Fig. ​Fig.2.2. Sodium citrate-citric acid (pH 3-6), Tris-HCl (pH 7.5-9.0), and glycine-NaOH (pH 10) buffers were used.

Enzyme catalytic domain analysis.

To define the catalytic domain of IspC, the 197-amino-acid N-terminal region encompassing a sequence (aa 58 to 197) highly homologous to the catalytic domain of the muramidase FlgJ from S. enterica serovar Typhimurium (40) was targeted for deletion analysis. Three deletion constructs were generated to synthesize recombinant EAD1 (aa 58 to 197), EAD2 (aa 58 to 263), and EAD3 (aa 1 to 197) for renaturing SDS-PAGE analysis of their hydrolytic activities over a broad pH range of from 3 to 10 (Fig. ​(Fig.8).8). At pH 7.5, where the full-length IspC showed its strong hydrolytic activity (Fig. ​(Fig.7),7), EAD3 did not appear to hydrolyze the substrate efficiently (Fig. ​(Fig.8,8, pH 7.5, lane 3), although the IPTG-induced EAD3 expression in E. coli led to cell lysis (i.e., a decrease in optical density and formation of fibrous materials), thus suggesting that it possesses peptidoglycan hydrolase activity. Cell lysis was similarly observed during induced expression of the full-length IspC. In contrast to the full-length IspC, EAD3 showed activity at acidic pHs but not at alkaline pHs, with a pH optimum of between 4 and 6. A double activity band was unexpectedly observed with EAD3, with strong activity associated with the smaller fragment, which is most likely to be the degraded product of EAD3. In contrast, neither EAD1 nor EAD2 exhibited hydrolytic activity over the broad range of pHs tested.

An external file that holds a picture, illustration, etc. Object name is zjb0050765450008.jpg

Mapping of a peptidoglycan hydrolase domain in the N-terminal region of IspC. Renaturing SDS-PAGE analysis of the purified recombinant proteins derived from the N-terminal region (lanes 1, EAD1 [aa 58 to 197]; lanes 2, EAD2 [aa 58 to 263]; lanes 3, EAD3 [aa 1 to 197]) was performed using the M. lysodeikticus ATCC 4698 substrate (0.2%, wt/vol) at various pHs. The same buffers as described in the legend to Fig. ​Fig.77 were used. The positions to which the purified EADs migrated were shown by Western blotting (WB), with probing with an anti-His MAb.

DISCUSSION

This study has demonstrated that an L. monocytogenes immunogenic protein of unknown function, IspC, identified previously by differential immunoscreening of an expression library of L. monocytogenes serotype 4b genomic DNA (Yu et al., submitted), is a novel surface-localized autolysin comprising an N-terminal enzyme catalytic domain and a C-terminal cell wall binding domain. Demonstration of antibodies to IspC in the antiserum RαL from rabbits infected with live L. monocytogenes but not in the antiserum RαK from rabbits receiving heat-killed bacteria in a previous study (Yu et al., submitted) and the present investigation suggested that IspC is induced or significantly upregulated in vivo during infection and thus is likely important in Listeria pathogenesis. The data from RT-PCR analysis of the ispC transcript and Western blot analysis of the encoded protein under the in vitro culture conditions revealed that the ispC gene was in fact expressed in vitro but only in the early exponential growth phase in a transient fashion. A relatively constant low level of the IspC protein observed in the stationary growth phase may indicate that the protein was quite stable and less susceptible to proteolytic degradation. This provides further evidence to support the proposal that IspC is significantly induced in vivo during infection and may thus play a role in virulence.

The combined results from both immunofluorescence microscopy and immunogold transmission electron microscopy showed that IspC is unevenly localized in clusters on the cell surface, in contrast to (i) the ring distribution of the Staphylococcus aureus autolysin Atl on the cell surface at the septal region, which is proposed to be required for efficient partitioning of daughter cells after cell division (55), and (ii) the polar position of the Streptococcus pneumoniae peptidoglycan hydrolase LytB on the surface, which is believed to be involved in separation of the daughter cells or chain dispersal, the final event of the cell division cycle (12). Further characterization of the binding of several GFPuv-tagged CBDs of various lengths to L. monocytogenes has defined a C-terminal domain responsible for anchoring IspC to the surface. The GFPuv-CBDs stained the bacterial surface evenly, in contrast to the uneven surface display of the authentic IspC, suggesting that targeting IspC to certain areas of the surface may be crucial for its biological functions that are different from those proposed for the S. aureus Atl and the S. pneumoniae LytB. The C-terminal cell wall binding domain of IspC contains seven GW modules, the function of which has been attributed to displaying the GW proteins on the surface via binding to the cell wall component lipoteichoic acid, as demonstrated for a number of other surface proteins from gram-positive bacteria, including Listeria (1, 5, 24, 39). Decoration of the L. monocytogenes surface with GFPuv-tagged CBDs showed that a CBD with all seven GW modules (i.e., CBD1) binds much more strongly than one with the first GW module partially or nearly completely deleted (i.e., CBD4). This suggests that the sequence integrity within a GW module is crucial for cell wall binding function. Related findings were obtained with L. monocytogenes InlB, for which the strength of cell wall binding is influenced by the number of GW modules (5, 24, 25). InlB with three GW modules was found in both cell surface-associated and released forms (25). Deletion or addition of GW modules resulted in a complete dissociation of an InlB variant bearing only one GW module and a complete retention of one containing eight GW modules (5, 24). In in vitro- or in vivo-grown L. monocytogenes, IspC with seven GW modules would be expected to be bound tightly on the surface. This notion is supported by two lines of experimental evidence reported here: (i) GFPuv-tagged CBD1 (with seven GW modules) binds strongly to the surface compared to CDB4 (with ca. six GW modules), and (ii) IspC was not detected by RαIspC antibody in the culture supernatant of L. monocytogenes serotype 4b (data not shown).

Bioinformatic analysis of the IspC sequence predicted a peptidoglycan hydrolase domain between aa 58 and 197 (Yu et al., submitted; Dan and Lin, unpublished data). Renaturing gel analysis showed that IspC was capable of hydrolyzing the cell wall substrates of not only L. monocytogenes but also other bacteria, such as M. lysodeikticus ATCC 4698 and E. coli ATCC 25922. The immunogenic protein IspC is thus first identified from experimental evidence as an autolysin according to the definition of autolysins, i.e., bacteriolytic enzymes that degrade the cell wall peptidoglycan (murein) of the bacteria that produce them (48). The catalytic domain of IspC was further experimentally defined in the N-terminal region (aa 1 to 197) with IspC deletion variants. Hydrolase activity analysis of these variants by using renaturing gels revealed that the sequence N terminal but not that C terminal to the putative catalytic domain (aa 58 to 197) was required for a hydrolytic function. Autolysins are ubiquitous among bacteria that can cleave covalent bonds in peptidoglycan substrates of their own cell walls (48) and thus can be potentially lethal. Regulation of antolysin activity would be expected to be important for the survival of bacteria, even though regulatory mechanisms are not known. Because of the extracellular nature of IspC and other known autolysins such as L. monocytogenes Ami (38), at least the microenvironmental factors such as the pH surrounding and within the cell walls are expected to contribute a great deal to regulate bacteriolytic activity of autolysins. Although IspC exhibited its hydrolytic activity in a wide range of pH, the enzyme functions much more efficiently at alkaline pHs than at acidic pHs, with an optimum pH of 7.5 to 9. In comparison, SKl, an N-acetylmuramoyl l-alanine amidase from Streptococcus mitis SK137, shows an optimum activity at pH 6.5 (32). That these optimum pH values ranged from near neutral to alkaline suggests that autolysins such as IspC should show limited enzymatic activity and thus avoid a potential lethal bacteriolytic effect on bacteria when exposed to a relatively low pH at several stages during infection, including the acidic environments of stomach and phagosome and low pH in acidified foods such as dairy products. The cell walls of Bacillus subtilis were demonstrated to be protonated during growth, suggesting that a relatively low-pH environment in the cell walls may provide one means of regulating autolysins during growth (10). In contrast to the full-length protein IspC, its N-terminal catalytic domain (i.e., EAD3) functions optimally at acidic pHs of from 4 to 6. The covalent linkage to EAD3 of the C-terminal cell wall binding domain (i.e., CBD1) with a predicted alkaline pI of 9.6 has resulted in a dramatic shift in the pH optimum to neutral to alkaline. This suggests that the IspC cell wall binding domain may be of importance in modulating the activity of the N-terminal enzyme domain. The importance of the C-terminal GW repeats for the autolytic function of an enzyme has been described for Atl in S. aureus (2) and Aas in Staphylococcus saprophyticus (21). Similarly, targeting of IspC to the cell wall through its C-terminal region containing GW modules may be necessary for the autolytic function. The separate N-terminal catalytic domain of IspC, however, exhibited hydrolytic activity in renaturing gels in the absence of the cell wall binding domain. It is likely that the IspC enzyme domain was retained in gels in close contact with the embedded bacterial cell walls, mimicking the cell wall targeting of the entire protein. GW modules in L. monocytogenes Ami and InlB have been shown to be directly involved in pathogenesis through binding to the host cell components (36, 38). Further study will be needed to determine whether the cell wall binding domain of IspC containing seven GW modules is involved in mediating binding to host cells.

The present study has resulted in addition of a novel peptidoglycan hydrolase, IspC, to the list of L. monocytogenes autolysins identified earlier, i.e., p60, p45, Ami, MurA, and Auto (42). In L. monocytogenes, murein-hydrolyzing activity of the flagellin FlaA was demonstrated (43), but its autolytic activity remained unknown. Bacterial autolysins are implicated in a number of cellular processes, including cell wall turnover, cell division, cell separation, chemotaxis, biofilm formation, genetic competence, protein secretion, antibiotic-induced lysis, sporulation, and formation of flagella (47, 49), and in pathogenesis (3, 11, 19, 20, 38, 51). Although further studies are required to elucidate the biological functions of the autolysin IspC and its role in virulence, it may be expected that IspC is involved in at least some of the cellular processes described for bacterial autolysins. Given that two L. monocytogenes autolysins, Ami and Auto, that are similar in structural organization to IspC play a role in pathogenesis (9, 38), it is suggested that the immunogenic autolysin IspC may contribute to bacterial virulence.

Acknowledgments

We acknowledge D. Franks for assistance with fluorescence microscopy, B. Phipps-Todd for help with electron microscopy, and the Small Animal Colony (Canadian Food Inspection Agency, Ottawa Laboratory Fallowfield) for rabbit immunization. We are also grateful for technical support from and discussion with H. Dan, W. L. Yu, B. S. Luo, J. Bennett, M.-E. Auclair, H. McRae, D. Todoric, M. Mallory, and E. Trottier.

Footnotes

▿Published ahead of print on 15 December 2006.

REFERENCES

1. Baba, T., and O. Schneewind. 1996. Target cell specificity of a bacteriocin molecule: a C-terminal signal directs lysostaphin to the cell wall of Staphylococcus aureus. EMBO J. 15:4789-4797. [PMC free article] [PubMed] [Google Scholar]
2. Baba, T., and O. Schneewind. 1998. Targeting of muralytic enzymes to the cell division site of Gram-positive bacteria: repeat domains direct autolysin to the equatorial surface ring of Staphylococcus aureus. EMBO J. 17:4639-4646. [PMC free article] [PubMed] [Google Scholar]
3. Berry, A. M., and J. C. Paton. 2000. Additive attenuation of virulence of Streptococcus pneumoniae by mutation of the genes encoding pneumolysin and other putative pneumococcal virulence proteins. Infect. Immun. 68:133-140. [PMC free article] [PubMed] [Google Scholar]
4. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. [PubMed] [Google Scholar]
5. Braun, L., S. Dramsi, P. Dehoux, H. Bierne, G. Lindahl, and P. Cossart. 1997. InlB: an invasion protein of Listeria monocytogenes with a novel type of surface association. Mol. Microbiol. 25:285-294. [PubMed] [Google Scholar]
6. Braun, L., B. Ghebrehiwet, and P. Cossart. 2000. gC1q-R/p32, a C1q-binding protein, is a receptor for the InlB invasion protein of Listeria monocytogenes. EMBO J. 19:1458-1466. [PMC free article] [PubMed] [Google Scholar]
7. Bula, C. J., J. Bille, and M. P. Glauser. 1995. An epidemic of food-borne listeriosis in western Switzerland: description of 57 cases involving adults. Clin. Infect. Dis. 20:66-72. [PubMed] [Google Scholar]
8. Cabanes, D., P. Dehoux, O. Dussurget, L. Frangeul, and P. Cossart. 2002. Surface proteins and the pathogenic potential of Listeria monocytogenes. Trends Microbiol. 10:238-245. [PubMed] [Google Scholar]
9. Cabanes, D., O. Dussurget, P. Dehoux, and P. Cossart. 2004. Auto, a surface associated autolysin of Listeria monocytogenes required for entry into eukaryotic cells and virulence. Mol. Microbiol. 51:1601-1614. [PubMed] [Google Scholar]
10. Calamita, H. G., W. D. Ehringer, A. L. Koch, and R. J. Doyle. 2001. Evidence that the cell wall of Bacillus subtilis is protonated during respiration. Proc. Natl. Acad. Sci. USA 98:15260-15263. [PMC free article] [PubMed] [Google Scholar]
11. Canvin, J. R., A. P. Marvin, M. Sivakumaran, J. C. Paton, G. J. Boulnois, P. W. Andrew, and T. J. Mitchell. 1995. The role of pneumolysin and autolysin in the pathology of pneumonia and septicemia in mice infected with a type 2 pneumococcus. J. Infect. Dis. 172:119-123. [PubMed] [Google Scholar]
12. De Las Rivas, B., J. L. Garcia, R. Lopez, and P. Garcia. 2002. Purification and polar localization of pneumococcal LytB, a putative endo-beta-N-acetylglucosaminidase: the chain-dispersing murein hydrolase. J. Bacteriol. 184:4988-5000. [PMC free article] [PubMed] [Google Scholar]
13. Donnelly, C. W. 2001. Listeria monocytogenes: a continuing challenge. Nutr. Rev. 59:183-194. [PubMed] [Google Scholar]
14. Dramsi, S., I. Biswas, E. Maguin, L. Braun, P. Mastroeni, and P. Cossart. 1995. Entry of Listeria monocytogenes into hepatocytes requires expression of inIB, a surface protein of the internalin multigene family. Mol. Microbiol. 16:251-261. [PubMed] [Google Scholar]
15. Dussurget, O., J. Pizarro-Cerda, and P. Cossart. 2004. Molecular determinants of Listeria monocytogenes virulence. Annu. Rev. Microbiol. 58:587-610. [PubMed] [Google Scholar]
16. Gaillard, J. L., P. Berche, C. Frehel, E. Gouin, and P. Cossart. 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from gram-positive cocci. Cell 65:1127-1141. [PubMed] [Google Scholar]
17. Goldfine, H., C. Knob, D. Alford, and J. Bentz. 1995. Membrane permeabilization by Listeria monocytogenes phosphatidylinositol-specific phospholipase C is independent of phospholipid hydrolysis and cooperative with listeriolysin O. Proc. Natl. Acad. Sci. USA 92:2979-2983. [PMC free article] [PubMed] [Google Scholar] Retracted
18. Goulet, V., J. Rocourt, I. Rebiere, C. Jacquet, C. Moyse, P. Dehaumont, G. Salvat, and P. Veit. 1998. Listeriosis outbreak associated with the consumption of rillettes in France in 1993. J. Infect. Dis. 177:155-160. [PubMed] [Google Scholar]
19. Heilmann, C., J. Hartleib, M. S. Hussain, and G. Peters. 2005. The multifunctional Staphylococcus aureus autolysin Aaa mediates adherence to immobilized fibrinogen and fibronectin. Infect. Immun. 73:4793-4802. [PMC free article] [PubMed] [Google Scholar]
20. Hell, W., H. G. Meyer, and S. G. Gatermann. 1998. Cloning of aas, a gene encoding a Staphylococcus saprophyticus surface protein with adhesive and autolytic properties. Mol. Microbiol. 29:871-881. [PubMed] [Google Scholar]
21. Hell, W., S. Reichl, A. Anders, and S. Gatermann. 2003. The autolytic activity of the recombinant amidase of Staphylococcus saprophyticus is inhibited by its own recombinant GW repeats. FEMS Microbiol. Lett. 227:47-51. [PubMed] [Google Scholar]
22. Hess, J., A. Dreher, I. Gentschev, W. Goebel, C. Ladel, D. Miko, and S. H. Kaufmann. 1996. Protein p60 participates in intestinal host invasion by Listeria monocytogenes. Zentralbl. Bakteriol. 284:263-272. [PubMed] [Google Scholar]
23. Hess, J., I. Gentschev, G. Szalay, C. Ladel, A. Bubert, W. Goebel, and S. H. Kaufmann. 1995. Listeria monocytogenes p60 supports host cell invasion by and in vivo survival of attenuated Salmonella typhimurium. Infect. Immun. 63:2047-2053. [PMC free article] [PubMed] [Google Scholar]
24. Jonquieres, R., H. Bierne, F. Fiedler, P. Gounon, and P. Cossart. 1999. Interaction between the protein InlB of Listeria monocytogenes and lipoteichoic acid: a novel mechanism of protein association at the surface of gram-positive bacteria. Mol. Microbiol. 34:902-914. [PubMed] [Google Scholar]
25. Jonquieres, R., J. Pizarro-Cerda, and P. Cossart. 2001. Synergy between the N- and C-terminal domains of InlB for efficient invasion of non-phagocytic cells by Listeria monocytogenes. Mol. Microbiol. 42:955-965. [PubMed] [Google Scholar]
26. Kathariou, S. 2002. Listeria monocytogenes virulence and pathogenicity, a food safety perspective. J. Food Prot. 65:1811-1829. [PubMed] [Google Scholar]
27. Kuhn, M., and W. Goebel. 1989. Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells. Infect. Immun. 57:55-61. [PMC free article] [PubMed] [Google Scholar]
28. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. [PubMed] [Google Scholar]
29. Lenz, L. L., S. Mohammadi, A. Geissler, and D. A. Portnoy. 2003. SecA2-dependent secretion of autolytic enzymes promotes Listeria monocytogenes pathogenesis. Proc. Natl. Acad. Sci. USA 100:12432-12437. [PMC free article] [PubMed] [Google Scholar]
30. Lin, M., H. Dan, and Y. Li. 2004. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene. Curr. Microbiol. 48:145-152. [PubMed] [Google Scholar]
31. Lin, M., D. Todoric, M. Mallory, B. S. Luo, E. Trottier, and H. Dan. 2006. Monoclonal antibodies binding to the cell surface of Listeria monocytogenes serotype 4b. J. Med. Microbiol. 55:291-299. [PubMed] [Google Scholar]
32. Llull, D., R. Lopez, and E. Garcia. 2006. Skl, a novel choline-binding N-acetylmuramoyl-l-alanine amidase of Streptococcus mitis SK137 containing a CHAP domain. FEBS Lett. 580:1959-1964. [PubMed] [Google Scholar]
33. Loessner, M. J., K. Kramer, F. Ebel, and S. Scherer. 2002. C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates. Mol. Microbiol. 44:335-349. [PubMed] [Google Scholar]
34. Lorber, B. 1997. Listeriosis. Clin. Infect. Dis. 24:1-9. [PubMed] [Google Scholar]
35. Lyytikainen, O., T. Autio, R. Maijala, P. Ruutu, T. Honkanen-Buzalski, M. Miettinen, M. Hatakka, J. Mikkola, V. J. Anttila, T. Johansson, L. Rantala, T. Aalto, H. Korkeala, and A. Siitonen. 2000. An outbreak of Listeria monocytogenes serotype 3a infections from butter in Finland. J. Infect. Dis. 181:1838-1841. [PubMed] [Google Scholar]
36. Marino, M., M. Banerjee, R. Jonquieres, P. Cossart, and P. Ghosh. 2002. GW domains of the Listeria monocytogenes invasion protein InlB are SH3-like and mediate binding to host ligands. EMBO J. 21:5623-5634. [PMC free article] [PubMed] [Google Scholar]
37. Mengaud, J., H. Ohayon, P. Gounon, R. M. Mege, and P. Cossart. 1996. E-cadherin is the receptor for internalin, a surface protein required for entry of L. monocytogenes into epithelial cells. Cell 84:923-932. [PubMed] [Google Scholar]
38. Milohanic, E., R. Jonquieres, P. Cossart, P. Berche, and J. L. Gaillard. 2001. The autolysin Ami contributes to the adhesion of Listeria monocytogenes to eukaryotic cells via its cell wall anchor. Mol. Microbiol. 39:1212-1224. [PubMed] [Google Scholar]
39. Milohanic, E., R. Jonquieres, P. Glaser, P. Dehoux, C. Jacquet, P. Berche, P. Cossart, and J. L. Gaillard. 2004. Sequence and binding activity of the autolysin-adhesin Ami from epidemic Listeria monocytogenes 4b. Infect. Immun. 72:4401-4409. [PMC free article] [PubMed] [Google Scholar]
40. Nambu, T., T. Minamino, R. M. Macnab, and K. Kutsukake. 1999. Peptidoglycan-hydrolyzing activity of the FlgJ protein, essential for flagellar rod formation in Salmonella typhimurium. J. Bacteriol. 181:1555-1561. [PMC free article] [PubMed] [Google Scholar]
41. Pistor, S., T. Chakraborty, U. Walter, and J. Wehland. 1995. The bacterial actin nucleator protein ActA of Listeria monocytogenes contains multiple binding sites for host microfilament proteins. Curr. Biol. 5:517-525. [PubMed] [Google Scholar]
42. Popowska, M. 2004. Analysis of the peptidoglycan hydrolases of Listeria monocytogenes: multiple enzymes with multiple functions. Pol. J. Microbiol. 53(Suppl.):29-34. [PubMed] [Google Scholar]
43. Popowska, M., and Z. Markiewicz. 2004. Murein-hydrolyzing activity of flagellin FlaA of Listeria monocytogenes. Pol. J. Microbiol. 53:237-241. [PubMed] [Google Scholar]
44. Potvin, C., D. Leclerc, G. Tremblay, A. Asselin, and G. Bellemare. 1988. Cloning, sequencing and expression of a Bacillus bacteriolytic enzyme in Escherichia coli. Mol. Gen. Genet. 214:241-248. [PubMed] [Google Scholar]
45. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
46. Schlech, W. F. III, P. M. Lavigne, R. A. Bortolussi, A. C. Allen, E. V. Haldane, A. J. Wort, A. W. Hightower, S. E. Johnson, S. H. King, E. S. Nicholls, and C. V. Broome. 1983. Epidemic listeriosis—evidence for transmission by food. N. Engl. J. Med. 308:203-206. [PubMed] [Google Scholar]
47. Shockman, G. D., L. Daneo-Moore, R. Kariyama, and O. Massidda. 1996. Bacterial walls, peptidoglycan hydrolases, autolysins, and autolysis. Microb. Drug. Resist. 2:95-98. [PubMed] [Google Scholar]
48. Shockman, G. D., and J.-V. Holtje. 1994. Microbial peptidoglycan (murein) hydrolases, p. 160-166. In J.-M. Ghuysen and R. Hakenbeck (ed.), Bacterial cell wall. Elsevier, Amsterdam, The Netherlands.
49. Smith, T. J., S. A. Blackman, and S. J. Foster. 2000. Autolysins of Bacillus subtilis: multiple enzymes with multiple functions. Microbiology 146:249-262. [PubMed] [Google Scholar]
50. Snyder, A., and H. Marquis. 2003. Restricted translocation across the cell wall regulates secretion of the broad-range phospholipase C of Listeria monocytogenes. J. Bacteriol. 185:5953-5958. [PMC free article] [PubMed] [Google Scholar]
51. Valisena, S., P. E. Varaldo, and G. Satta. 1991. Staphylococcal endo-beta-N-acetylglucosaminidase inhibits response of human lymphocytes to mitogens and interferes with production of antibodies in mice. J. Clin. Investig. 87:1969-1976. [PMC free article] [PubMed] [Google Scholar]
52. Vazquez-Boland, J. A., M. Kuhn, P. Berche, T. Chakraborty, G. Dominguez-Bernal, W. Goebel, B. Gonzalez-Zorn, J. Wehland, and J. Kreft. 2001. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14:584-640. [PMC free article] [PubMed] [Google Scholar]
53. Vines, A., and B. Swaminathan. 1998. Identification and characterization of nucleotide sequence differences in three virulence-associated genes of Listeria monocytogenes strains representing clinically important serotypes. Curr. Microbiol. 36:309-318. [PubMed] [Google Scholar]
54. Wuenscher, M. D., S. Kohler, A. Bubert, U. Gerike, and W. Goebel. 1993. The iap gene of Listeria monocytogenes is essential for cell viability, and its gene product, p60, has bacteriolytic activity. J. Bacteriol. 175:3491-3501. [PMC free article] [PubMed] [Google Scholar]
55. Yamada, S., M. Sugai, H. Komatsuzawa, S. Nakashima, T. Oshida, A. Matsumoto, and H. Suginaka. 1996. An autolysin ring associated with cell separation of Staphylococcus aureus. J. Bacteriol. 178:1565-1571. [PMC free article] [PubMed] [Google Scholar]
56. Yu, W. 2004. The gene products of Listeria monocytogenes induced specifically during rabbit infection. M.Sc. thesis. University of Ottawa, Ottawa, Canada.
Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)
-