Production of a gonadotropin-releasing hormone 2 receptor knockdown (GNRHR2 KD) swine line

Vector preparation, production of lentiviral particles and ST cell transduction

Utilizing oligomer design software (Clontech, Mountain View, CA), two potential target small hairpin (shRNA) sequences, shRNA1 (TGGCTACTCAGTTTCCTTC) and shRNA2 (CTGTCATGACCATCTGCTA), specific to the porcine GNRHR2 (NCBI accession number {"type":"entrez-nucleotide","attrs":{"text":"NM_001001639.2","term_id":"402692660","term_text":"NM_001001639.2"}}NM_001001639.2) were identified and subcloned into a lentiviral-based, pLVX-shRNA2 vector (Cat # 632179; Clontech) that provides both ubiquitous shRNA and fluorescent ZsGreen1 co-expression. Neither shRNA sequences matched other genes in the porcine genome including GNRHR (NCBI accession number {"type":"entrez-nucleotide","attrs":{"text":"JN120792.1","term_id":"388255268","term_text":"JN120792.1"}}JN120792.1). The shRNA expression was driven by the human U6 promoter, whereas ZsGreen1 expression was controlled by the cytomegalovirus (CMV) promoter. Lentiviral particles were produced from each shRNA vector, as well as a control vector, by transfection with Fugene6 (Promega, Madison, WI) and the Lenti-X HTX Packaging Mix into Lenti-X 293T cells (Clontech). Briefly, 4 × 10⁶ cells were plated in 10 cm dishes at approximately 70% confluency, and cells were transfected with 5 µg of vector, 15 µl of Lenti-X HTX Packaging Mix (Clontech) and 30 μl Fugene6 (Promega). Approximately 48 h later, particles were harvested and concentrated (100X) with Lenti-X Concentrator (Clontech) according to the manufacturer’s instructions. Titrations of viral particles were performed by infecting swine testis-derived (ST) cells (CRL-1746; ATCC, Manassas, VA) with serial dilutions of lentivirus and counting fluorescent cells to determine infectious units (IU)/ml.

The ability of shRNA1 and shRNA2 lentiviral particles to ablate porcine GNRHR2 mRNA levels was tested in ST cells. The day prior to transduction, ST cells (1.2 × 10⁶ cells/plate) were plated in 100 mm plates containing high-glucose Dulbecco’s Modified Eagle’s Medium (Mediatech, Herndon, VA) supplemented with 10% FBS, 2 mM glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin sulfate (Gibco, Grand Island, NY). Cells were transduced with 1.44 × 10⁷ viral particles per plate for 48 h. At 48 h post-transduction, RNA was isolated from ST cells with TRIzol (1.5 ml/plate; Invitrogen, Grand Island, NY) per manufacturer’s instructions and stored at −20 °C until reverse transcription (RT).

Quantitative PCR

Ribonucleic acid from ST cells was DNase treated with RQ1 (Promega) and quantitated using a Nanodrop spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE). The RNA was reverse transcribed into cDNA with M-MLV (Promega) and random hexamers (Promega). The PCR amplification of GNRHR2 was performed using forward (F-CCCCGGACAAGGAAGGG) and reverse (R-AAGGAGCGACGGAGGGTCAA) primers (Integrated DNA Technologies, Coralville, Iowa) as well as a FAM labeled TaqMan MGB probe (ATGATGCCCCTGCCGG; Applied Biosystems, Foster City, CA). Quantitative PCR was performed on cDNA samples with an ABI 7900 HT instrument (Applied Biosystems). The amplification protocol included an initial 50 °C step for 2 min followed by 95 °C for 10 min and then alternating temperatures between 95 °C for 15 s and 60 °C for 1 min, repeated 50 times. The housekeeping gene was eukaryotic RNA18S (kit #4319413E; VIC/MGB Probe; Applied Biosystems). Cycling conditions for RNA18S were the same as those described for GNRHR2. Internal controls included samples prepared without reverse transcriptase (no RT control) and without cDNA (water only control).

Generation of transgenic pigs

RNA interference (RNAi) has successfully been employed to impair gene expression in a variety of mammalian cells (Dann 2007; Park 2007; Roelz et al. 2010; Rubinson et al. 2003). Transducing zygotes via viral particles has generated transgenic mice (Miao et al. 2011; Rubinson et al. 2003), rats (Dann 2007), chickens (McGrew et al. 2004), goats (Golding et al. 2006) and pigs (Hofmann et al. 2003; Whitelaw et al. 2004). In this study, we utilized lentiviral particles and RNAi to produce a transgenic model to study the function of GNRHR2 in swine. Briefly, zygotes (n = 50) were surgically flushed from the oviduct of one superovulated, white crossbred donor sow. Embryos were collected in Beltsville embryo culture medium (BECM; 19.3 mM sodium lactate, 2.13 mM calcium lactate, 90 mM sodium chloride, 4.83 mM potassium chloride, 0.54 mM magnesium chloride, 2.14 mM sodium bicarbonate, 10.91 mM Hepes free acid, 0.55 mM glucose, 11 mM mannitol, 1 mM l-glutamine, 7 mM taurine, 0.27 mM sodium pyruvate, 80 mM EDTA free acid, 0.001% phenol red, 1% BSA, 50 μg gentamycin sulfate; Dobrinsky et al. 1996) and cultured briefly (1 h) prior to microinjection. All reagents for BECM were purchased from Sigma (St. Louis, MO) except l-glutamine, EDTA and gentamycin sulfate (Gibco). Embryos were microinjected with lentiviral particles according to a protocol generously shared by Dr. Charles Long (Texas A&M University, College Station, TX). Briefly, embryos were placed in 100 µl microdrops of BECM + 200 mM sucrose (Fisher, Fair Lawn, NJ) on micromanipulation plates (100 × 15 mm petri dish; VWR International, Batavia, IL) layered with embryo-tested mineral oil (M8410; Sigma). Sucrose was utilized to retract the cytoplasm from the zona pellucida to facilitate microinjection into the perivitelline space (Miao et al. 2011). Using a holding pipet (VacuTip; ID = 15 µm; OD = 100 µm; Eppendorf, AF, Hamburg, Germany) and an intracytoplasmic sperm injection (ICSI) needle (TransferTip-F; ID = 4 µm; OD = 7 µm; Eppendorf) backloaded with 5 µl of lentiviral particles (1.15 × 10⁹ IU/ml), each embryo was microinjected within the perivitelline space for 30 s using the manual setting (pi = 150 hPa; pf = 0 hPa) on the Eppendorf Femtojet injection system with a Nikon diaphot inverted microscope (Melville, NY). A total of 40 microinjected zygotes were surgically transferred into the oviduct of one synchronized recipient female, which was allowed to gestate to term.

Confirmation of transgene integration

Upon birth of piglets from the recipient, expression of ZsGreen1 was examined with a UV light and a Roscolux #15 (deep straw; Rosco, Port Chester, NY) filter. In addition, genomic DNA was isolated from tail samples using a DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). Transgene integration was evaluated via conventional PCR using primers designed to amplify a portion of the human U6 promoter driving the shRNA (F-GAGGGCCTATTTCCCATGAT; R-GATCCTCGTCCTTTCCACAA), a region from the U6 promoter to the multiple cloning site (U6/MCS) to verify incorporation of the shRNA sequence (F- GAGGGCCTATTTCCCATGAT; R-GGGCGTACTTGGCATATGAT), and a portion of the ZsGreen1 coding sequence (F-CTGCATGTACCACGAGTCCA; R-GTCAGCTTGTGCTGGATGAA). The Philisa Thermocycler (Streck Inc., Omaha, NE) was used for rapid evaluation of samples with the following conditions for both the U6 and ZsGreen1 reactions: 1 X Taq Buffer A (Fisher) with a final concentration of 3.0 mM MgCl₂, 200 µM dNTPs, 400 nM of each primer and 1.25 U of Taq DNA Polymerase (Fisher). Cycling conditions were 95 °C for 60 s, followed by 35 cycles of 95 °C for 5 s, 55 °C for 5 s and 72 °C for 10 s and a final extension of 72 °C for 20 s. The U6/MCS PCR reaction conditions were the same, however the cycling conditions were as follows: 95 °C for 60 s, followed by 35 cycles of 95 °C for 10 s, 56 °C for 10 s and 72 °C for 15 s and a final extension of 72 °C for 30 s. The resultant PCR products were subjected to electrophoresis on a 1% agarose gel.

Inverse PCR was performed as described previously (Cederberg et al. 2015) to determine the location and number of integration sites. Briefly, genomic DNA was digested with XbaI or HindIII and fragments were self-ligated with a high concentration of T4 DNA ligase (0.1 IU/µl; Thermo Scientific Fermentas, Pittsburg, PA) and a low concentration (2 µg/µl) of DNA. PCR was performed on the circularized DNA with primers selected from the integrated pLVX-shRNA2 sequence (XbaI-F: GAGATCCCTCAGACCCTTTT, XbaI-R: GTTGCGTCAGCAAACACAGT; HindIII-F: GAGCCCTCAGATCCTGCATA, HindIII-R: AGCACCATCCAAAGGTCAGT) and in reverse orientation of typical primers. Resultant PCR products were sequenced with nested primers for XbaI (TCCCTCAGACCCTTTTAGTCA) and HindIII (CTGGCCCTGGTGTGTAGTTC) derived products at the University of Nebraska Medical Center Genomic Core Facility (Omaha, NE).

Characterization of GNRHR2 KD swine line

At 40, 100, 150, 190, 225 and 300 days of age, testis size of GNRHR2 KD (n = 10) and littermate control (n = 7) boars was measured using digital calipers. Predicted testis volume was calculated using the following equation: Volume = 3/4(π)(L/2)(W/2)², where L = testis length and W = testis width (Bailey et al. 1998). Body weight was recorded and blood samples were collected via jugular venipuncture. Blood samples were allowed to clot at 4 °C overnight before centrifugation (2000 × g). Serum was collected and stored at −20 °C until use. Transgenic (n = 5) and littermate control boars (n = 4) were subsequently euthanized (717 ± 24 days of age) by intravenous injection of Fatal-Plus Solution (1 mg/4.5 kg; pentobarbital; Vortech Pharmaceuticals, Dearborn, MI). Testicular tissue was collected immediately and stored in RNAlater (100 mg/ml; Qiagen) at −20 °C for subsequent mRNA analysis.

Radioimmunoassay

Unextracted serum was analyzed in duplicate to quantify concentrations of testosterone by a double antibody radioimmunoassay (RIA) kit (cat # 07-189102; MP Biomedicals, Aurora, OH), in accordance with manufacturer’s instructions. Additional standards (0.03 and 0.16 ng/ml) were added to reach the sensitivity of the assay (0.03 ng/ml). The intra- and inter-assay coefficients of variation (CV) were 6.5 and 7.7%, respectively. Concentrations of LH were determined by RIA at the Colorado State University Reproductive Endocrinology Laboratory (Fort Collins, CO). The intra- and inter-assay CV were 2.7 and 6.2%, respectively.

Digital droplet PCR

Digital droplet PCR (ddPCR) was used to quantify the abundance of GNRHR2 mRNA in testes of transgenic (n = 5) and control (n = 4) boars. Samples were removed from RNAlater and homogenized in TRIzol (1 ml; Invitrogen) with a Tissue Tearor (Biospec Products Inc., Bartlesville, OK). Total RNA was subsequently extracted using standard procedures with chloroform and isopropyl alcohol. Ribonucleic acid was DNAse treated, quantitated on a Nanodrop spectrophotometer (NanoDrop Technologies, Inc.) and reverse transcribed (2 ug) into cDNA as described above.

To quantify GNRHR2 transcript levels, specific primers (Integrated DNA Technologies) and a FAM labeled TaqMan MGB probe (Applied Biosystems) were utilized as described above. Each reaction contained 1 µl of the cDNA template (undiluted), 900 nM of each primer, 250 nM of the probe and ddPCR Supermix for Probes (Bio-Rad, Richmond, CA). Droplets were generated using the QX200 Droplet Generator (Bio-Rad) according to manufacturer’s instructions. A C1000 Touch Thermal Cycler (Bio-Rad) was utilized with the following conditions: 95 °C for 5 min (enzyme activation), 95 °C for 30 s (denaturation) followed by 60 °C for 1 min (annealing/extension; 40 cycles), 4 °C for 5 min and 90 °C for 5 min (signal stabilization). Droplets were read via the QX200 droplet reader (Bio-Rad) and analyzed using Quantasoft Software (Bio-Rad). The housekeeping gene utilized was ACTB; each reaction contained 1 µl of the cDNA template (diluted 1:100), 100 nM of each primer (F-AACTCCATCATGAAGTGCGACG; R-GATCCACATCTGCTGGAAGG) and EvaGreen ddPCR Supermix (Bio-Rad). Cycling conditions for ACTB were the same as those described for GNRHR2 reactions.

The authors are grateful to Sara Stauffer and Trevor DeVries for pig husbandry as well as Matt Snyder, Amy Voss, Jill Kerl, Scott Kurz and Bill Pohlmeier for technical assistance. The authors would like to thank Dr. J. Joe Ford for his advice and insight. The authors also express gratitude to Streck, Inc. (Omaha, NE) for use of the Philisa Thermocycler. This work was partially supported by National Institute of Food and Agriculture Hatch (NEB-26-199; BRW) and Agriculture and Food Research Initiative funds (2011-67015; CAL). A contribution to the University of Nebraska Agricultural Research Division, Lincoln, NE, 68583.