Skip to main content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
J Immunol. Author manuscript; available in PMC 2021 Aug 15.
Published in final edited form as:
J Immunol. 2020 Aug 15; 205(4): 915–922.
Published online 2020 Jun 26. doi: 10.4049/jimmunol.2000583
PMCID: PMC7566074
NIHMSID: NIHMS1603963
PMID: 32591393

A potently neutralizing antibody protects mice against SARS-CoV-2 infection

Wafaa B. Alsoussi,#*,2 Jackson S. Turner,#*,2 James B. Case,#†,2 Haiyan Zhao,#*,2 Aaron J. Schmitz,#*,2 Julian Q. Zhou,#‡,2 Tingting Lei,* Amena A. Rizk,* Katherine M. McIntire,* Rita E. Chen,† Ahmed O. Hassan,† Julie M. Fox,† Emma S. Winkler,*† Larissa B. Thackray,† Natasha M. Kafai,*† Fatima Amanat,§ Florian Krammer,§ Corey T. Watson,ǁ Steven H. Kleinstein,‡# Daved H. Fremont,*,**†† Michael S. Diamond,*†**§§ and Ali H. Ellebedy*,**§§,3
Author information Copyright and License information PMC Disclaimer

Associated Data

Supplementary Materials

Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is responsible for millions of infections and hundreds of thousands of deaths globally. There are no widely available licensed therapeutics against SARS-CoV-2, highlighting an urgent need for effective interventions. The virus enters host cells through binding of a receptor binding domain (RBD) within its trimeric spike glycoprotein to human angiotensin-converting enzyme 2. Here, we describe the generation and characterization of a panel of murine monoclonal antibodies (mAbs) specific for the RBD. One mAb, 2B04, neutralized wild type SARS-CoV-2 in vitro with remarkable potency (half-maximal inhibitory concentration of <2 ng/mL). In a novel murine model of SARS-CoV-2 infection, 2B04 protected challenged animals from weight loss, reduced lung viral load, and blocked systemic dissemination. Thus, 2B04 is a promising candidate for an effective antiviral that can be used to prevent SARS-CoV-2 infection.

Introduction

Most members of the Coronaviridae family infect the respiratory tract of mammals, causing mild respiratory disease (1). In the past two decades, however, two highly pathogenic coronaviruses (CoVs), severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV), crossed the species barrier and led to epidemics with high morbidity and mortality in humans (2–4). In December 2019, a third highly pathogenic human coronavirus, SARS-CoV-2 emerged in Wuhan, Hubei province of China (5–7). Compared to SARS-CoV and MERS-CoV, SARS-CoV-2 appears to be more readily transmitted among humans, spreading to multiple continents and leading to the World Health Organization’s declaration of a coronavirus disease 2019 (COVID-19) pandemic (8, 9). As of 28 April 2020, SARS-CoV-2 caused more than three million confirmed cases globally, leading to at least 200,000 deaths (10). Currently, there are no widely available licensed therapeutics to prevent or treat COVID-19. This underlines the need for immediate development of prophylactic and therapeutic reagents to combat SARS-CoV-2 virus infection.

Betacoronavirus entry into host cells is mediated by a densely glycosylated spike (S) protein that forms homotrimers protruding from the viral envelope (11). The S protein is comprised of an N-terminal S1 subunit responsible for virus-receptor binding and a C-terminal S2 subunit that mediates virus-cell membrane fusion (12). SARS-CoV-2 gains entry into host cells initially through the interaction between the receptor-binding domain (RBD) within its S1 subunit with the cellular receptor, human angiotensin-converting enzyme 2 (hACE2) and subsequently by fusion between the viral envelope and the host cell lipid bilayer mediated by the S2 subunit (13, 14). This points to the RBD as a critical target for antibody-based treatments to prevent SARS-CoV-2 virus infection and limit its spread. Indeed, several pre-clinical studies demonstrated that polyclonal antibodies induced against SARS-CoV and MERS-CoV RBD can inhibit viral entry (15, 16). Such critical proof-of-concept findings suggest that SARS-CoV-2 RBD could be used as an immunogen to elicit potently neutralizing antibodies that block SARS-CoV-2 entry.

Passive administration of monoclonal antibodies (mAbs) has become one of the essential tools in treating many human diseases, including those caused by emerging viruses (17). Indeed, in the face of the West African ebolavirus outbreak of 2013–2016, two therapeutic recombinant mAb preparations, REGN-EB3 and MAb114, showed significant efficacy in preventing death (18–20). Based on the likelihood of protective antibodies being induced by natural infection, sera from convalescent patients are currently being used as an experimental treatment for COVID-19. However, it remains unclear how non-neutralizing or weakly neutralizing antibodies, which are also likely elicited by infection, alter viral infectivity and disease progression (15). Therefore, there is an urgent need to develop and fully characterize potently neutralizing mAbs that can be quickly harnessed for the prevention and treatment of SARS-CoV-2 infection.

Materials and Methods

Cells, viruses, and recombinant proteins

Expi293F cells (Gibco) were cultured at 37°C in Expi293 Expression medium (Gibco). Vero E6 cells (CRL-1586, ATCC), Vero CCL81 (ATCC), and HEK293 were cultured at 37°C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1x non-essential amino acids, and 100 U/ml of penicillin–streptomycin.. SARS-CoV-2 strain 2019 n-CoV/USA_WA1/2020 was obtained from the Centers for Disease Control and Prevention (gift of Natalie Thornburg) (21). A p3 stock was passaged once in CCL81-Vero cells and titrated by focus-forming assay on Vero E6 cells.

The adenoviral AdV-hACE2-GFP construct and defective virus preparation has been reported previously (22). AdV-hACE2-GFP was propagated in 293T cells and purified by cesium chloride density-gradient ultracentrifugation. The number of virus particles was determined using optical density (260 nm) measurement and plaque assay, as previously described (23). The viral stock titer was determined to be 1011 PFU/mL.

DNA fragments encoding ectodomain of spike from SARS-CoV1 (residues 14–1193, GenBank: AY278488.2), SARS-CoV2 (residues 14–1211, GenBank: MN908947.3) and MERS-CoV (residues 19–1294, GenBank: JX869059.2) were synthesized and placed into the mammalian expression vector pFM1.2 with N-terminal mu-phosphatase signal peptide. The C-terminus of all DNAs were engineered with a HRV3C protease cleavage site (GSTLEVLFQGP) linked by a foldon trimerization motif (YIPEAPRDGQAYVRKDGEWVLLSTFL) and an 8XHis Tag. The S1/S2 furin cleavage sites were mutated in both SARS-CoV2 and MERS-CoV S, and all three S proteins were stabilized with the 2P mutations (24). The plasmids were transiently transfected in Expi293F cells using FectoPRO reagent (Poluplus) and cell supernatants containing target protein were harvested 96h after transfection. The soluble S proteins were recovered using 2mL cobalt-charged resin (G-Biosciences). Mammalian SARS-CoV2 RBD (residues 331−524) was cloned into vector pFM1.2 with N-terminal mu-phosphatase signal peptide and C-terminal 6XHis Tag. The protein was expressed as S protein and recovered by nickel agarose beads (Goldbio), further purified by passage over S75i Superdex (GE Healthcare). The bacterial version of RBD was cloned into the pET21a vector (Novagen) and expressed as inclusion bodies in Escherichia coli BL21(DE3) and purified as previously described for ZIKV DIII (25).

Mouse immunization

All procedures involving animals were performed in accordance with guidelines of Institutional Animal Care and Use Committee of Washington University in Saint Louis.

Female C57BL/6J mice (Jackson Laboratories) were immunized intramuscularly with 10 μg SARS-CoV-2 RBD resuspended in PBS emulsified with AddaVax (InvivoGen). Two weeks later, mice were boosted with 5 μg SARS-CoV-2 S protein twice, at 10-day intervals. One control mouse received PBS emulsified with AddaVax according to the same schedule. Sera were collected 5 days after the final boost and stored at −20°C before use. Draining iliac and inguinal lymph nodes were also harvested on day 5 after the final boost for plasmablast sorting.

Cell sorting

Staining for sorting was performed using fresh lymph node single cell suspensions in PBS supplemented with 2% FBS and 1mM EDTA (P2). Cells were stained for 30 min on ice with biotinylated recombinant SARS-CoV-2 RBD diluted in P2, washed twice, then stained for 30 min at 4°C with Fas-PE (Jo2, BD Pharmingen), CD4-eFluor 780 (GK1.5, eBioscience), CD138-BV421 (281–2), IgD-FITC (11–26c.2a), GL7-PerCP-Cy5.5, CD38-PE-Cy7 (90), CD19-APC (1D3), and Zombie Aqua (all Biolegend) diluted in P2. Cells were washed twice and single SARS-CoV-2 RBD-specific PBs (live singlet CD19+ CD4− IgDlo Fas+ CD38lo CD138+ RBD+) and total PBs (live singlet CD19+ CD4− IgDlo Fas+ CD38lo CD138+) were sorted using a FACSAria II into 96-well plates containing 2 μL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) and immediately frozen on dry ice or bulk sorted into PBS supplemented with 0.05% BSA and processed for single cell RNAseq.

Monoclonal antibody (mAb) generation

Antibodies were cloned as previously described (26). In brief, VH, Vκ, and Vλ genes were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR from singly-sorted SARS-CoV-2 RBD+ plasmablasts using cocktails of primers specific for IgG, IgM/A, Igκ, and Igλ using first round and nested primer sets (26–28) (Table S2) and then sequenced. Clonally related cells were identified by the same length and composition of IGHV, IGHJ and heavy-chain CDR3 and shared somatic hypermutation at the nucleotide level. To generate recombinant antibodies, heavy chain V-D-J and light chain V-J fragments were PCR-amplified from 1st round PCR products with mouse variable gene forward primers and joining gene reverse primers having 5’ extensions for cloning by Gibson assembly as previously described (29) (Table S2), and were cloned into pABVec6W antibody expression vectors (30) in frame with either human IgG, IgK, or IgL constant domain. Plasmids were co-transfected at a 1:2 heavy to light chain ratio into Expi293F cells using the Expifectamine 293 Expression Kit (Thermo Fisher), and antibodies were purified with protein A agarose (Invitrogen).

Enzyme-linked immunosorbent assay

Ninety-six-well microtiter plates (Nunc MaxiSorp; Thermo Fisher Scientific) were coated with 100 μL recombinant SARS-CoV-2 S or RBD at a concentration of 0.5 μg/mL and 1 μg/mL, respectively, in 1X PBS (Gibco) at 4 °C overnight; negative control wells were coated with 1 μg/mL BSA (Sigma). Plates were blocked for 1.5 h at room temperature with 280 μL blocking solution (1X PBS supplemented with 0.05% Tween-20 (Sigma) and 10% FBS (Corning)). The mAbs were diluted to a starting concentration of 10 μg/mL, serially diluted 1:3, and incubated for 1 h at room temperature. The plates were washed three times with T-PBS (1X PBS supplemented with 0.05% Tween-20), and 100 μL anti-human IgG horseradish peroxidase (HRP) antibody (goat polyclonal; Jackson ImmunoResearch) diluted 1:2,500 in blocking solution was added to all wells and incubated for 1 h at room temperature. Plates were washed 3 times with T-PBS and 3 times with 1X PBS, and 100 μL peroxidase substrate (SigmaFast o-phenylenediamine dihydrochloride; Sigma) was added to all wells. The reaction was stopped after 5 min using 100 μL 1M hydrochloric acid, and the plates were read at a wavelength of 490 nm using a microtiter plate reader (BioTek). The data were analyzed using Prism v8 (GraphPad). The minimum positive concentration was defined as having optical density at least three-fold above background.

Mouse serum ELISAs were performed similarly. Plates were coated and blocked as above. The sera were pre-diluted 1:30 and then serially diluted 1:3. Anti-mouse IgG horseradish peroxidase antibody (goat polyclonal; Southern Biotech) diluted 1:1,000 in blocking solution was used as secondary antibody.

Single cell RNAseq library preparation and sequencing

Libraries were prepared using the following 10x Genomics kits: Chromium Single Cell 5’ Library and Gel Bead Kit v2 (PN-1000006), Chromium Single Cell A Chip Kit (PN-1000152), Chromium Single Cell V(D)J Enrichment Kit, Mouse, Bcell (96rxns) (PN-1000072), and Single Index Kit T (PN-1000213). The cDNAs were prepared after the GEM generation and barcoding, followed by GEM RT reaction and bead cleanup steps. Purified cDNA was amplified for 10–14 cycles before being cleaned up using SPRIselect beads. Samples were then run on a Bioanalyzer to determine cDNA concentration. BCR target enrichments were done on the full-length cDNA. GEX and enriched BCR libraries were prepared as recommended by 10x Genomics Chromium Single Cell V(D)J Reagent Kits (v1 Chemistry) user guide with appropriate modifications to the PCR cycles based on the calculated cDNA concentration. The cDNA Libraries were sequenced on Novaseq S4 (Illumina), targeting a median sequencing depth of 50,000 and 5,000 read pairs per cell for gene expression and BCR libraries, respectively.

Genomic sequences of immunoglobulin genes in Mus musculus C57BL/6 strain

We obtained a list of 262 annotated immunoglobulin (Ig) genes with “IG_*_gene” for their “gene_biotype” from the Ensembl 93 gene annotation (31) for the current genome assembly for the C57BL/6 strain of Mus musculus (GRCm38, or mm10) (32). The genes Ighv1–13, Ighv5–8, and Iglc4 were removed due to being annotated as pseudogenes by both Mouse Genome Informatics (MGI) and NCBI Gene and having biotype conflicts with Ensembl. The final list of 259 mm10 Ig genes included 113 Ighv genes, 17 Ighd genes, 4 Ighj genes, 100 Igkv genes, 5 Igkj genes, 3 Iglv genes, 5 Iglj genes, 8 Ighc genes, 1 Igkc gene, and 3 Iglc genes. Genomic sequences for these genes were retrieved based on their Ensembl IDs via the Ensembl REST API (release 13.0) (33).

IMGT Ig reference alleles for Mus musculus

Ig reference alleles (release 202011–3) for mouse were downloaded from the ImMunoGeneTics information system (IMGT) on 2020–04-02 under the “F+ORF+in frame P” configuration (34). Alleles annotated as Mus spretus were removed, leaving only alleles annotated as Mus musculus. The final list of IMGT alleles for Mus musculus included 406 IGHV alleles, 38 IGHD alleles, 9 IGHJ alleles, 150 IGKV alleles, 10 IGKJ alleles, 14 IGLV alleles, 5 IGLJ alleles, 106 IGHC alleles, 3 IGKC alleles, and 3 IGLC alleles.

Curation for C57BL/6-specific Ig reference alleles

To identify the closest IMGT allele, each mm10 Ig gene was aligned against the IMGT alleles for its corresponding gene segment using blastn (v2.9.0) (35). For Ighd genes, blastn-short was also used to accommodate short sequence lengths. For each mm10 Ig gene, a search for the IMGT allele with 100% match for the full length of the allele was conducted (Table S3).

For each of 247 out of the 259 mm10 genes, one or more matching alleles were identified. For 18 of these 247 mm10 genes, two IMGT alleles were identified with identical nucleotide sequences and full-length 100% matches. Where possible (16 out of 18), the allele with name matching that of the mm10 Ig gene was designated as the corresponding IMGT allele. For example, the identical IMGT alleles IGKV4–54*01 and IGKV4–52*01 both matched with mm10 gene Igkv4–54; in this case, IGKV4–54*01 was noted as the corresponding C57BL/6 IMGT allele. Where this was not possible (2 out of 18), an allele was chosen based on the locus representation map. For Ighd5–7, which matched with IGHD6–1*01 and IGHD6–3*01, IGHD6–3*01 was chosen. For Ighd5–8, which matched with IGHD6–1*02 and IGHD6–4*01, IGHD6–4*01 was chosen. For the 247 mm10 genes with full-length 100% matches with IMGT alleles, the corresponding IMGT alleles were used as the curated reference alleles.

For mm10 genes Ighv1–62-1, Ighv12–3, Ighv2–3, Ighv8–2, and Ighv8–4, length discrepancies were noted at the 3’ end in the form of additional nucleotides in the closest matching IMGT alleles: IGHV1–62-1*01, 2 bp; IGHV12–3*01, 1 bp; IGHV2–3*01, 3 bp; IGHV8–2*01, 1 bp; and IGHV8–4*01, 7 bp. In each case, the sequence immediately downstream of the mm10 gene was examined in the Ensembl Genome Browser (36) for identification of candidate heptamer-spacer-nonamer recombination signal sequence (RSS) motif under the 12/23 rule (37). For Ighv1–62-1, an RSS motif was observed immediately adjacent to the final nucleotide annotated in mm10. In this case, the additional nucleotide in the IMGT allele was not included for the curated reference allele. For Ighv12–3, Ighv2–3, Ighv8–2, and Ighv8–4, evidence for putative RSS motifs were observed adjacent to the final nucleotides of the IMGT alleles. In these cases, the additional nucleotides in the IMGT alleles were included for the curated reference alleles.

For mm10 genes Igkv3–7, Igkv9–120, Ighg2b, and Ighg3, IGKV3–7*01, IGKV9–120*01, and IGHG2B*02, and IGHG3*01 were identified as the closest IMGT alleles with, respectively, 1, 1, 3, and 3 nucleotide mismatches. For the mismatched positions, the curated reference alleles deferred to the nucleotides found in the corresponding mm10 genomic sequences.

For mm10 genes Igkc, Iglc1, and Iglc3, length discrepancies were noted at the 5’ end, where the mm10 genomic sequences begin, in the form of 1 additional nucleotide each in the closest matching IMGT alleles: IGKC*01, IGLC*01, and IGLC*03. The curated reference alleles deferred to the mm10 genomic sequences and did not include the additional nucleotide found in IMGT alleles.

The final curated set of C57BL/6 reference alleles included 113 IGHV alleles, 17 IGHD alleles, 4 IGHJ alleles, 100 IGKV alleles, 5 IGKJ alleles, 3 IGLV alleles, 5 IGLJ alleles, 8 IGHC alleles, 1 IGKC allele, and 3 IGLC alleles (Table S3).

Processing of single-cell BCR sequences

Demultiplexed pair-end FASTQ reads from 10x Genomics single-cell V(D)J profiling were preprocessed using the “cellranger vdj” command from Cell Ranger v3.1.0 for alignment against the GRCm38 mouse reference v3.1.0 (refdata-cellranger-vdj-GRCm38-alts-ensembl-3.1.0), generating 15,270 assembled high-confidence BCR sequences for 6,635 cells. Primers were removed from paired heavy and light chain monoclonal antibody (mAb) sequences from 34 cells using the “MaskPrimers” command from pRESTO v0.5.11, (38). The 10x Genomics and mAb sequences were combined with paired heavy and light chain nested PCR sequences from 100 cells. Germline V(D)J gene annotation was performed for all sequences using IgBLAST v1.15.0, (39) with a curated set of immunoglobulin reference alleles specific for the C57BL/6 strain of Mus musculus (see above section). IgBLAST output was parsed using Change-O v0.4.6, (40). Additional quality control required sequences to be productively rearranged and have valid V and J gene annotations, consistent chain annotation (excluding sequences annotated with heavy chain V gene and light chain J gene), and a junction length that is a multiple of 3. Furthermore, only cells with exactly one heavy chain sequence paired with at least one light chain sequence were kept. After processing, there were 6,262 cells with paired heavy and light chains, including 83 cells with nested PCR sequences, 34 cells with mAb sequences, and 6,145 cells with 10x Genomics BCR sequences.

Clonal lineage inference

B cell clonal lineages were inferred using hierarchical clustering with single linkage (41). Cells were first partitioned based on common heavy and light chain V and J gene annotations and junction region lengths, where junction was defined to be from IMGT codon 104 encoding the conserved cysteine to codon 118 encoding phenylalanine or tryptophan (42). Within each partition, cells whose heavy chain junction regions were within 0.1 normalized Hamming distance from each other were clustered as clones. This distance threshold was determined by manual inspection in conjunction with kernel density estimates, in order to identify the local minimum between the two modes of the bimodal distance-to-nearest distribution (Fig. S2A). Following clonal clustering, full-length clonal consensus germline sequences were reconstructed for the heavy chains in each clone with D-segment and N/P regions masked with N’s, resolving any ambiguous gene assignments by majority rule.

Calculation of mutation frequency

Mutation frequency was calculated for cells with 10x Genomics BCRs by counting the number of nucleotide mismatches from the germline sequence in the heavy chain variable segment leading up to the CDR3. Calculation was performed using the calcObservedMutations function from SHazaM v0.2.3 (40).

Processing of 10x Genomics single-cell 5’ gene expression data

Demultiplexed pair-end FASTQ reads were preprocessed using the “cellranger count” command from 10x Genomics’ Cell Ranger v3.1.0 for alignment against the GRCm38 mouse reference v3.0.0 (refdata-cellranger-mm10–3.0.0). A feature UMI count matrix containing 7,485 cells and 31,053 features was generated. The biotypes of the features were retrieved from the GTF annotation of Ensembl release 93 (31). Additional quality control was performed as follows. 1) To remove presumably lysed cells, cells with mitochondrial content greater than 15% of all transcripts were removed. 2) To remove likely doublets, cells with more than 5,000 features or 80,000 total UMIs were removed. 3) To remove cells with no detectable expression of common housekeeping mouse genes, cells with no transcript for any of Actb, Gapdh, B2m, Hsp90ab1, Gusb, Ppih, Pgk1, Tbp, Tfrc, Sdha, Ldha, Eef2, Rpl37, Rpl38, Leng8, Heatr3, Eif3f, Chmp2a, Psmd4, Puf60, and Ppia were removed (43, 44). 4) The feature matrix was subset, based on their biotypes, to protein-coding, immunoglobulin, and T cell receptor genes that were expressed in at least 0.1% of the cells. 5) Cells with detectable expression of fewer than 200 genes were removed. After quality control, the final feature matrix contained 7,264 cells and 11,507 genes.

Single-cell gene expression analysis

Single-cell gene expression analysis was performed using Seurat v3.1.1 (45). UMI counts measuring gene expression were log-normalized. The top 2,000 highly variable genes (HVGs) were identified using the “FindVariableFeatures” function with the “vst” method. Mouse homologs for a set of 293 immune-related, “immunoStates” human genes (46) were added to the HVG list, while immunoglobulin and T cell receptor genes were removed. The mouse homologs were obtained by first looking up the Human and Mouse Homology Class report from Mouse Genome Informatics (MGI) (47), accessed on 2020-04-06, and then manually searching NCBI Gene for the human genes for which MGI reported no mouse homolog. The data was then scaled and centered, and principal component analysis (PCA) was performed based on the expression of the HVGs. PCA-guided t-distributed stochastic neighbor embedding (tSNE) was performed using the top 20 principal components.

Gene expression-based clusters were identified using the “FindClusters” function with resolution 0.05. Differentially expressed genes for each cluster were identified via the “FindAllMarkers” function using Wilcoxon Rank Sum tests, followed by Bonferroni correction for multiple testing. The identities of the clusters were assigned by examining the expression of canonical marker genes and differentially expressed genes. The plasmablast clusters were based on high expression of Cd79a, Cd79b, Xbp1, Sdc1, and Fkbp11. One of the plasmablast clusters was highly proliferating based on high expression of Mki67, Top2a, Cdk1, Ccna2, and Cdca3. The T cell cluster was based on high expression of Cd8b1, Ms4a4b, Cd3d, Cd3e, Ccr7, and Il7r.

SARS-CoV-2 neutralization assay

3-fold serial dilutions of mouse sera and mAbs were incubated with 102 focus forming units (FFU) of SARS-CoV-2 at 37°C for 1 h. Antibody-virus mixtures were added to Vero E6 cell monolayers in 96-well plates and incubated at 37°C for 1 hour. After incubation, cells were overlaid with 1% (w/v) methylcellulose in minimal essential medium (MEM) supplemented with 2% FBS. Plates were harvested 30 hours later by removing overlays and fixed with 4% paraformaldehyde (PFA) in PBS for 20 min at room temperature. Plates were washed six times with PBS and sequentially incubated with 1 μg/mL of CR3022 anti-S protein antibody (48) and HRP-conjugated goat anti-human IgG in PBS supplemented with 0.1% saponin and 0.1% BSA. SARS-CoV-2 foci were visualized by incubating monolayers with TrueBlue peroxidase substrate (KPL) for 20 min at room temperature and quantitated using an ImmunoSpot microanalyzer (Cellular Technologies). Data were processed and neutralization curves generated using Prism v8 (GraphPad).

ACE2 competition assay

The ACE2 competition binding assay was performed at 25°C on an Octet Red bilayer interferometry (BLI) instrument (ForteBio) using anti-human IgG Fc biosensors to capture target antibody. Briefly, antibodies were loaded onto anti-human IgG Fc pins for 3 min at 10 μg/mL in assay buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, and 0.005% P20 surfactant with 3% BSA). Unbound antibodies were washed away, and the IgG-loaded tips were dipped into RBD-containing wells for 1min or 3 min, followed by immersion into wells containing 1 μM ACE2 protein. The mAbs were considered competing if no additional BLI signal was observed compared to control mAb hE16 (humanized West Nile virus-specific mAb), whereas increased signal indicated inability of mAbs to block RBD binding to ACE2.

SARS-CoV-2 challenge

Eight-week old male BALB/cJ mice (Jackson Laboratories) were administered 2 mg of anti-IFNAR1 (MAR1–5A3, Leinco) (49) via intraperitoneal injection 24 hours prior to intranasal administration of 2.5 × 108 PFU of AdV-hACE2. Five days later, mice were inoculated intranasally with 4×105 FFU of SARS-CoV-2. Weight was monitored daily, animals were euthanized 4 or 6 days post-infection, perfused with 20 mL of PBS, and tissues were harvested. For histological analysis, the right lung was inflated with ~1.2 mL of 10% neutral buffered formalin using a 3-mL syringe and catheter inserted into the trachea. For fixation after infection, inflated lungs were kept in a 40-mL suspension of neutral buffered formalin for 7 days before further processing. Lungs were embedded in paraffin, and sections were stained with hematoxylin and eosin. Tissue sections were visualized using a Nikon Eclipse microscope equipped with an Olympus DP71 color camera or a Leica DM6B microscope equipped with a Leica DFC7000T camera. For viral load analyses, collected tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1mL of DMEM media supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 rpm for 5 min and stored at −80°C. RNA was extracted using MagMax mirVana Total RNA isolation kit (Thermo Scientific) and a Kingfisher duo prime extraction machine (Thermo Scientific). Viral burden was determined by RT-qPCR (L Primer: ATGCTGCAATCGTGCTACAA; R primer: GACTGCCGCCTCTGCTC; probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/) and for lung samples, by plaque assay on Vero E6 cells. Briefly, homogenates were serially diluted 10-fold and applied to Vero E6 cell monolayers in 12-well plates. Plates were incubated at 37°C for 1h with rocking every 15 minutes. Subsequently, cells were overlaid with 1% (w/v) methylcellulose in MEM supplemented with 2% FBS. Plates were harvested 72h later by removing overlays and fixed with 4% PFA in PBS for 20 min at room temperature. After removing the 4% PFA, plaques were visualized by adding 1mL/well 0.05% crystal violet in 20% methanol for 20 min at room temperature. Excess crystal violet was washed away with PBS and plaques were counted.

Results

We immunized two mice intramuscularly (i.m.) with 10 μg of recombinant SARS-CoV-2 RBD in squalene-based adjuvant. Fourteen days after primary immunization, mice were boosted twice with 5 μg of recombinant SARS-CoV-2 S protein, at a 10-day interval (Fig. 1A). Serum antibody binding to SARS-CoV-2 recombinant trimeric S protein or RBD was measured by enzyme-linked immunosorbent assay (ELISA) 5 days after the final booster immunization. Serum from both mice demonstrated potent binding to both SARS-CoV-2 RBD and S protein (Fig. 1B). Serum samples from the immunized mice were also evaluated for neutralization of a SARS-CoV-2 isolate (2019 n-CoV/USA_WA1/2020) (21). Potent neutralizing activities (IC50 titers of 0.002112 and 0.0006774) against SARS-CoV-2 were found for both mice in a focus reduction neutralization test (FRNT) (Fig. 1C). These results suggest that our immunization strategy successfully induced RBD and S protein-specific and neutralizing antibody responses.

An external file that holds a picture, illustration, etc. Object name is nihms-1603963-f0001.jpg
Isolation of SARS-CoV-2 RBD-specific murine mAbs

A. Immunization regimen. C57BL/6J mice were immunized with 10 μg SARS-CoV-2 RBD i.m. and boosted with 5 μg S protein 14 and 24 days later. Serum and dLNs were harvested 5 days after the second boost. B. IgG serum Ab ELISA for SARS-CoV-2 S protein (left panel) and RBD (right panel). C. Serum neutralization activity against SARS-CoV-2 strain 2019 n-CoV/USA_WA1/2020 using a focus reduction neutralization test (FRNT). Values normalized to serum from a PBS-immunized mouse. D. Sorting strategies for total PBs (grey gate) and RBD+ PBs (red gate) from dLNs pooled from both mice. Total PBs were bulk-sorted for single-cell RNA sequencing, and RBD+ PBs were single-cell sorted for mAb cloning. E. mAb screening ELISA for binding to SARS-CoV-2 RBD.

To further characterize the antibody response, plasmablasts (PBs) were sorted from draining lymph nodes pooled from both mice 5 days after the final boost immunization. We sorted single RBD-binding PBs for cloning and evaluation of the antibody response and total PBs in bulk for single-cell RNA-sequencing (scRNA-seq) (Fig. 1D, S1A). For mAb generation, immunoglobulin heavy (IGHV) and kappa (IGKV) and lambda (IGLV) light chain variable genes were cloned into a human IgG1 expression vector and expressed as murine/human chimeric mAbs as previously described (26–28). Thirty-four mAbs were expressed and screened for binding to recombinant SARS-CoV-2 RBD expressed in mammalian cells, of which 26 were positive (Fig. 1E).

One hundred and seventeen IGHV sequences were cloned from two 96-well plates of singly sorted PBs, of which 47 were clonally distinct (Fig. 2A, S2A). Nineteen clonal lineages comprised the 26 mAbs that bound to SARS-CoV-2 RBD. We selected a representative mAb from each clonal lineage (Table S1) and verified that all 19 mAbs bound to the recombinant SARS-CoV-2 RBD with minimum positive concentrations ≤5 μg/mL (Fig. 2B). To more comprehensively characterize the transcriptional profile, isotype distribution, and somatic hypermutation among responding PBs, we analyzed bulk-sorted total PBs using scRNA-seq. Gene expression-based clustering of PBs revealed two populations, Ki67hi and Ki67low, corresponding to proliferation states among responding PBs (Fig. 2C, S2B). We then identified the B cell receptor (BCR) sequences from the scRNA-seq data that were clonally related to those encoding the RBD-specific mAbs and found that these RBD-specific clones were distributed homogenously between both PB populations (Fig. 2D, S2C). The RBD-specific clones were mostly isotype-switched, with IgG+ cells comprising the vast majority (640 of 657) of RBD+ cells (Fig. 2E). Additionally, the mutation frequency of RBD-specific clones was higher compared to RBD-negative clones (Fig. 2F, S2D), indicating that our immunization strategy resulted in selective enrichment of a more mature and isotype switched RBD-specific PB response among the total S protein-induced B cell response.

An external file that holds a picture, illustration, etc. Object name is nihms-1603963-f0002.jpg
SARS-CoV-2 RBD-binding plasmablast response is clonally diverse

A. Clonal diversity of single-cell sorted RBD-binding PB sequences. Each slice represents one clone; width represents frequency distribution. B. Minimum positive concentrations of clonally unique mAbs as determined by SARS-CoV-2 RBD ELISA of mammalian cell-expressed RBD; positive binding defined as greater than 3x background. Representative of 3 independent experiments. Dotted line represents limit of detection. C. Gene expression-based clustering visualized via t-distributed stochastic neighbor embedding. D. Plasmablasts found in clones containing RBD+ (red) and RBD− (gray) mAbs. E. Isotypes of plasmablasts found in clones containing RBD+ mAbs. IgG are shown in pink, IgM in blue, and IgE in green. F. IGHV nucleotide mutation frequency of plasmablasts found in clones containing RBD+ (red; n=657) and RBD− (gray; n=5263) mAbs. Lines represent medians. P-value from two-sided Mann-Whitney.

Multiple amino acid variations exist between SARS-CoV-2 and SARS-CoV RBDs and to a much larger extent between SARS-CoV-2 and MERS-CoV RBDs (13, 50). To determine whether our mAbs recognize distinct or conserved epitopes, we tested their binding to SARS-CoV-2, SARS-CoV, and MERS-CoV S proteins. The 19 mAbs bound recombinant SARS-CoV-2 S protein, with five (2C02, 2E06, 1C05, 1C07, and 2E10) recognizing SARS-CoV, but none binding to MERS-CoV S protein (Fig. 3A-​-C).C). The five cross-reactive mAbs recognized the SARS-CoV RBD (Fig. S3A–C). Despite binding SARS-CoV-2 RBD, 1A12 and 2H04 weakly bound SARS-CoV S protein but not RBD, and 2B04 weakly bound SARS-CoV and MERS-CoV RBD. Because binding is not an indicator for antiviral capacity, we tested whether any of the mAbs had neutralizing activity against SARS-CoV-2 strain 2019 n-CoV/USA_WA1/2020 using a Vero E6 cell focus reduction neutralization test (FRNT). Five of the mAbs (1B10, 2B04, 1B07, 1E07 and 2H04) displayed strong neutralizing activity against SARS-CoV-2. Among these, mAb 2B04 displayed the most potent neutralizing activity against SARS-CoV-2, with a remarkable IC50 value of 1.46 ng/mL (Fig. 3D, S3D). All neutralizing mAbs except 2H04 competed with human ACE2 (hACE2) for binding to RBD (Fig. S3E).

An external file that holds a picture, illustration, etc. Object name is nihms-1603963-f0003.jpg
Cross-reactivity, ACE2 competition, and neutralization capacity of RBD-binding mAbs

A–C. Minimum positive concentrations of clonally unique mAbs as determined by SARS-CoV-2 (A), SARS-CoV (B), and MERS-CoV (C) S protein ELISA; positive binding defined as greater than 3x background. Representative of 3 independent experiments. D. Half maximal infection inhibitory concentrations of clonally distinct anti-RBD mAbs against SARS-CoV-2 strain 2019 n-CoV/USA_WA1/2020 in an FRNT. Mean ±SEM from 2 (1B10) or 3 (all other mAbs) independent experiments. Daggers indicate mAbs that compete with hACE2 binding to RBD; see also Fig. S3E. Dotted lines represent limit of detection.

To assess the protective capacities of 2B04 and 2H04 in vivo, we utilized a mouse model of SARS-CoV-2 infection in which hACE2 is transiently expressed via a non-replicating adenoviral vector (hACE2-AdV) (22). BALB/c mice were transduced with hACE2-AdV via intranasal (i.n.) administration to establish receptor expression in lung tissues. Animals then received 10 mg/kg 2B04, 2H04, or isotype control via intraperitoneal (i.p.) injection one day before infection with the SARS-CoV-2 strain 2019 n-CoV/USA_WA1/2020 (Fig. 4A). Mice receiving 2B04 lost significantly less body weight compared to those receiving isotype control mAb, and those receiving 2H04 trended toward decreased weight loss (Fig. 4B, Fig. S4A). Viral load was measured at the peak of viral burden in this model, 4 days post-infection, in the lung and spleen (M. Diamond and colleagues, in press). Compared to the isotype control mAb-treated mice, animals receiving 2B04 had 31- and 11-fold, and those receiving 2H04 had 6- and 5-fold lower median levels of viral RNA in the lung and spleen, respectively (Fig. 4C, Fig. S4 B). Furthermore, those receiving 2B04 had no detectable infectious virus in the lungs by plaque assay (Fig. 4D). Consistent with the reduction of infectious virus titers in lungs from animals treated with 2B04, infiltration of inflammatory cells was substantially decreased within the alveolar spaces in 2B04-treated animals compared to those treated with an isotype control mAb (Fig. S4C, D). Altogether these data indicate that 2B04 can limit SARS-CoV-2 disease and reduce viral dissemination.

An external file that holds a picture, illustration, etc. Object name is nihms-1603963-f0004.jpg
In vivo protection by mAb 2B04

A. SARS-CoV-2 challenge model. BALB/c mice received αIFNAR1 mAb i.p. 24 hours prior to i.n. administration of AdV-hACE2. Mice received 10mg/kg mAb 2B04 or isotype i.p. 4 days later, followed by i.n. challenge with SARS-CoV-2 strain 2019 n-CoV/USA_WA1/2020 one day later. Mice were weighed daily, and tissues were collected 4 days post-challenge. B–D. Percent of baseline weight (B) and viral titers measured in the indicated tissue by RT-qPCR (C) and plaque assay (D) 4 days post-challenge of mice that received isotype (open circles) or 2B04 (closed circles). Data from 3 independent experiments with 14–15 mice per group (B, C) or 1 experiment with 6 mice per group (D). Mean ±SEM shown in B. *, P<0.05, **, P<0.005; P-values from two-sided Mann-Whitney.

Discussion

Here we describe a panel of RBD-binding mAbs generated from mice immunized with recombinant SARS-CoV-2 RBD and boosted with S protein. Consistent with a recent report (51), none of the neutralizing mAbs strongly cross-reacted with SARS-CoV and MERS-CoV RBD, although one neutralizing SARS-CoV mAb that cross-reacts with SARS-CoV-2 has been recently described (52). Notably, all neutralizing mAbs except 2H04 competed with hACE2 for binding to RBD. 2H04 activity is reminiscent of CR3022, a mAb that recognizes an epitope within the RBD that does not overlap with the hACE2 binding site (48). This result suggests that the isolated anti-RBD mAbs described here bind non-overlapping epitopes and can efficiently neutralize the virus via potentially distinct mechanisms and therefore may demonstrate enhanced protective capacity if used in combination. The latter point is critical as it would decrease the chance of escape mutants emerging following the use of each mAb alone. Several mAbs recognized epitopes that apparently overlapped with hACE2 binding site based on the hACE2 competition assay but did not show substantial neutralizing activity. The basis for this remains unknown but could be attributed to low binding affinity or steric hindrance that impedes engagement of the RBD on the virion surface.

One mAb, 2B04, was particularly potent in the in vitro FRNT with an IC50 of 1.46 ng/mL and was protective in vivo. Other SARS-CoV-2 neutralizing mAbs that bind RBD and are protective in vivo in both prophylactic and therapeutic settings have recently been described (53, 54), though their in vitro neutralizing concentrations are at least 10-fold higher. A critical question for any candidate therapeutic mAb is whether a sub-optimal dose could enhance viral infection (55, 56). Further studies could best address this question using native models of infection, such as hamsters (57).

In summary, we isolated an array of 19 PB-derived clonally distinct murine mAbs that are directed against the RBD within the S protein of the SARS-CoV-2 virus. Five of these mAbs have strong neutralizing activity (IC50 <0.5 μg/mL) against wild-type infectious SARS-CoV-2. One mAb, 2B04, showed highly potent neutralizing activity, protected mice against weight loss, and reduced viral burden, making it a promising candidate for therapeutic development.

​

Key points

Rapid generation of SARS-CoV-2 receptor binding domain-specific monoclonal antibodies

Monoclonal antibody 2B04 potently neutralizes SARS-CoV-2 in vitro

2B04 protects mice from morbidity in a novel murine model of SARS-CoV-2 infection

Supplementary Material

Acknowledgements

We thank Erica Lantelme for facilitating sorting; the Genome Technology Access Center (GTAC) in the Department of Genetics at Washington University School of Medicine and the Yale Center for Genome Analysis for help with genomic analysis.

The contents of this publication are solely the responsibility of the authors and do not necessarily represent the official views of NIAID or NIH. Work in Ellebedy laboratory was supported by NIAID R21 AI139813, U01 AI141990, and NIAID Centers of Excellence for Influenza Research and Surveillance (CEIRS) contract HHSN272201400008C. Work in the Diamond laboratory was partially supported by was supported by NIH contracts and grants 75N93019C00062 and R01 AI127828 and the Defense Advanced Research Project Agency HR001117S0019. Work in the Fremont laboratory was partially supported by NIAID contracts HHSN272201700060C and 75N93019C00062. Work in the Kleinstein laboratory was partially supported by NIH R01AI104739. Work in the Krammer laboratory was partially supported by the NIAID CEIRS contract HHSN272201400008C and Collaborative Influenza Vaccine Innovation Centers contract 75N93019C00051. The Genome Technology Access Center in the Department of Genetics at Washington University School of Medicine is partially supported by NCI Cancer Center Support Grant #P30 CA91842 to the Siteman Cancer Center and by ICTS/CTSA Grant# UL1 TR000448 from the NCRR. JST was supported by NIAID 5T32CA009547. JBC was supported by a Helen Hay Whitney postdoctoral fellowship.

Abbreviations used in this article:

AdVadenovirus
COVID-19coronavirus disease 2019
CoVscoronaviruses
FRNTfocus reduction neutralization test
hACE2human angiotensin-converting enzyme 2
MERS-CoVMiddle East respiratory syndrome coronavirus
PBplasmablast
RBDreceptor-binding domain of S protein
S proteincoronavirus spike glycoprotein
SARS-CoVsevere acute respiratory syndrome coronavirus
SARS-CoV-2Severe acute respiratory syndrome coronavirus 2
scRNAseqsingle-cell RNA sequencing
tSNEt-distributed stochastic neighbor embedding

Footnotes

Data and materials availability: Raw fastq files, associated RNA sequencing, and processed gene expression data have been uploaded to the NCBI Gene Expression Omnibus/Sequence Read Archive database (https://www.ncbi.nlm.nih.gov/geo/, https://www.ncbi.nlm.nih.gov/sra) under identifiers SRP256045 and GSE149036. Antibody sequences are deposited on Genbank (accession nos. MT341590-MT341641, available from GenBank/EMBL/DDBJ, https://www.ncbi.nlm.nih.gov/genbank/). All other data are available in the main text or the supplementary materials. Materials used in the analysis are available from the participating laboratories under standard academic material transfer agreements.

Declaration of interests

A.H.E. is a consultant for Inbios and Fimbrion Therapeutics. S.H.K. receives consulting fees from Northrop Grumman. M.S.D. is a consultant for Inbios, Eli Lilly, Vir Biotechnology, NGM Biopharmaceuticals, and on the Scientific Advisory Board of Moderna. The Ellebedy laboratory received funding under sponsored research agreements from Emergent BioSolutions. The Diamond laboratory at Washington University School of Medicine has received sponsored research agreements from Moderna and Emergent BioSolutions. All other authors declare no conflict of interest.

References

1. Corman VM, Lienau J, and Witzenrath M. 2019. Coronaviruses as the cause of respiratory infections. Internist (Berl). 60: 1136–1145. [PMC free article] [PubMed] [Google Scholar]
2. Drosten C, Günther S, Preiser W, van der Werf S, Brodt H-R, Becker S, Rabenau H, Panning M, Kolesnikova L, Fouchier RAM, Berger A, Burguière A-M, Cinatl J, Eickmann M, Escriou N, Grywna K, Kramme S, Manuguerra J-C, Müller S, Rickerts V, Stürmer M, Vieth S, Klenk H-D, Osterhaus ADME, Schmitz H, and Doerr HW. 2003. Identification of a Novel Coronavirus in Patients with Severe Acute Respiratory Syndrome. N. Engl. J. Med 348: 1967–1976. [PubMed] [Google Scholar]
3. Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, Tong S, Urbani C, Comer JA, Lim W, Rollin PE, Dowell SF, Ling A-E, Humphrey CD, Shieh W-J, Guarner J, Paddock CD, Rota P, Fields B, DeRisi J, Yang J-Y, Cox N, Hughes JM, LeDuc JW, Bellini WJ, and Anderson LJ. 2003. A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. N. Engl. J. Med 348: 1953–1966. [PubMed] [Google Scholar]
4. Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus ADME, and Fouchier RAM. 2012. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. N. Engl. J. Med 367: 1814–1820. [PubMed] [Google Scholar]
5. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, Zhao X, Huang B, Shi W, Lu R, Niu P, Zhan F, Ma X, Wang D, Xu W, Wu G, Gao GF, and Tan W. 2020. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med 382: 727–733. [PMC free article] [PubMed] [Google Scholar]
6. Zhou P, Yang X-L, Wang X-G, Hu B, Zhang L, Zhang W, Si H-R, Zhu Y, Li B, Huang C-L, Chen H-D, Chen J, Luo Y, Guo H, Jiang R-D, Liu M-Q, Chen Y, Shen X-R, Wang X, Zheng X-S, Zhao K, Chen Q-J, Deng F, Liu L-L, Yan B, Zhan F-X, Wang Y-Y, Xiao G-F, and Shi Z-L. 2020. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579: 270–273. [PMC free article] [PubMed] [Google Scholar]
7. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, Zhang L, Fan G, Xu J, Gu X, Cheng Z, Yu T, Xia J, Wei Y, Wu W, Xie X, Yin W, Li H, Liu M, Xiao Y, Gao H, Guo L, Xie J, Wang G, Jiang R, Gao Z, Jin Q, Wang J, and Cao B. 2020. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395: 497–506. [PMC free article] [PubMed] [Google Scholar]
8. Chan JF-W, Yuan S, Kok K-H, To KK-W, Chu H, Yang J, Xing F, Liu J, Yip CC-Y, Poon RW-S, Tsoi H-W, Lo SK-F, Chan K-H, Poon VK-M, Chan W-M, Ip JD, Cai J-P, Cheng VC-C, Chen H, Hui CK-M, and Yuen K-Y. 2020. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster. Lancet 395: 514–523. [PMC free article] [PubMed] [Google Scholar]
9. Li Q, Guan X, Wu P, Wang X, Zhou L, Tong Y, Ren R, Leung KSM, Lau EHY, Wong JY, Xing X, Xiang N, Wu Y, Li C, Chen Q, Li D, Liu T, Zhao J, Liu M, Tu W, Chen C, Jin L, Yang R, Wang Q, Zhou S, Wang R, Liu H, Luo Y, Liu Y, Shao G, Li H, Tao Z, Yang Y, Deng Z, Liu B, Ma Z, Zhang Y, Shi G, Lam TTY, Wu JT, Gao GF, Cowling BJ, Yang B, Leung GM, and Feng Z. 2020. Early Transmission Dynamics in Wuhan, China, of Novel Coronavirus–Infected Pneumonia. N. Engl. J. Med 382: 1199–1207. [PMC free article] [PubMed] [Google Scholar]
10. WHO. 2020. WHO COVID-19 Dashboard. . [Google Scholar]
11. Li F 2016. Structure, Function, and Evolution of Coronavirus Spike Proteins. Annu. Rev. Virol 3: 237–261. [PMC free article] [PubMed] [Google Scholar]
12. Bosch BJ, van der Zee R, de Haan CAM, and Rottier PJM. 2003. The Coronavirus Spike Protein Is a Class I Virus Fusion Protein: Structural and Functional Characterization of the Fusion Core Complex. J. Virol 77: 8801–8811. [PMC free article] [PubMed] [Google Scholar]
13. Wang Q, Zhang Y, Wu L, Niu S, Song C, Zhang Z, Lu G, Qiao C, Hu Y, Yuen K-Y, Wang Q, Zhou H, Yan J, and Qi J. 2020. Structural and Functional Basis of SARS-CoV-2 Entry by Using Human ACE2. Cell S0092–8674(20)30338-X. [PMC free article] [PubMed] [Google Scholar]
14. Shang J, Ye G, Shi K, Wan Y, Luo C, Aihara H, Geng Q, Auerbach A, and Li F. 2020. Structural basis of receptor recognition by SARS-CoV-2. Nature 581: 221–224. [PMC free article] [PubMed] [Google Scholar]
15. Du L, He Y, Zhou Y, Liu S, Zheng B-J, and Jiang S. 2009. The spike protein of SARS-CoV — a target for vaccine and therapeutic development. Nat. Rev. Microbiol 7: 226–236. [PMC free article] [PubMed] [Google Scholar]
16. Xu J, Jia W, Wang P, Zhang S, Shi X, Wang X, and Zhang L. 2019. Antibodies and vaccines against Middle East respiratory syndrome coronavirus. Emerg. Microbes Infect. 8: 841–856. [PMC free article] [PubMed] [Google Scholar]
17. Newsome BW, and Ernstoff MS. 2008. The clinical pharmacology of therapeutic monoclonal antibodies in the treatment of malignancy; have the magic bullets arrived? Br. J. Clin. Pharmacol 66: 6–19. [PMC free article] [PubMed] [Google Scholar]
18. Marston HD, Paules CI, and Fauci AS. 2018. Monoclonal Antibodies for Emerging Infectious Diseases — Borrowing from History. N. Engl. J. Med 378: 1469–1472. [PubMed] [Google Scholar]
19. Corti D, Misasi J, Mulangu S, Stanley DA, Kanekiyo M, Wollen S, Ploquin A, Doria-Rose NA, Staupe RP, Bailey M, Shi W, Choe M, Marcus H, Thompson EA, Cagigi A, Silacci C, Fernandez-Rodriguez B, Perez L, Sallusto F, Vanzetta F, Agatic G, Cameroni E, Kisalu N, Gordon I, Ledgerwood JE, Mascola JR, Graham BS, Muyembe-Tamfun J-J, Trefry JC, Lanzavecchia A, and Sullivan NJ. 2016. Protective monotherapy against lethal Ebola virus infection by a potently neutralizing antibody. Science (80-. ). 351: 1339–1342. [PubMed] [Google Scholar]
20. Levine MM 2019. Monoclonal Antibody Therapy for Ebola Virus Disease. N. Engl. J. Med 381: 2365–2366. [PubMed] [Google Scholar]
21. Harcourt J, Tamin A, Lu X, Kamili S, Sakthivel SK, Murray J, Queen K, Tao Y, Paden CR, Zhang J, Li Y, Uehara A, Wang H, Goldsmith C, Bullock HA, Wang L, Whitaker B, Lynch B, Gautam R, Schindewolf C, Lokugamage KG, Scharton D, Plante JA, Mirchandani D, Widen SG, Narayanan K, Makino S, Ksiazek TG, Plante KS, Weaver SC, Lindstrom S, Tong S, Menachery VD, and Thornburg NJ. 2020. Severe Acute Respiratory Syndrome Coronavirus 2 from Patient with 2019 Novel Coronavirus Disease, United States. Emerg. Infect. Dis 26. [PMC free article] [PubMed] [Google Scholar]
22. Jia HP, Look DC, Shi L, Hickey M, Pewe L, Netland J, Farzan M, Wohlford-Lenane C, Perlman S, and McCray PB. 2005. ACE2 Receptor Expression and Severe Acute Respiratory Syndrome Coronavirus Infection Depend on Differentiation of Human Airway Epithelia. J. Virol 79: 14614–14621. [PMC free article] [PubMed] [Google Scholar]
23. Mittereder N, March KL, and Trapnell BC. 1996. Evaluation of the concentration and bioactivity of adenovirus vectors for gene therapy. J. Virol 70: 7498–7509. [PMC free article] [PubMed] [Google Scholar]
24. Pallesen J, Wang N, Corbett KS, Wrapp D, Kirchdoerfer RN, Turner HL, Cottrell CA, Becker MM, Wang L, Shi W, Kong WP, Andres EL, Kettenbach AN, Denison MR, Chappell JD, Graham BS, Ward AB, and McLellan JS. 2017. Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen. Proc. Natl. Acad. Sci. U. S. A 114: E7348–E7357. [PMC free article] [PubMed] [Google Scholar]
25. Zhao H, Fernandez E, Dowd KA, Speer SD, Platt DJ, Gorman MJ, Govero J, Nelson CA, Pierson TC, Diamond MS, and Fremont DH. 2016. Structural Basis of Zika Virus-Specific Antibody Protection. Cell 166: 1016–1027. [PMC free article] [PubMed] [Google Scholar]
26. Von Boehmer L, Liu C, Ackerman S, Gitlin AD, Wang Q, Gazumyan A, and Nussenzweig MC. 2016. Sequencing and cloning of antigen-specific antibodies from mouse memory B cells. Nat. Protoc 11: 1908–1923. [PubMed] [Google Scholar]
27. Ehlers M, Fukuyama H, McGaha TL, Aderem A, and Ravetch JV. 2006. TLR9/MyD88 signaling is required for class switching to pathogenic IgG2a and 2b autoantibodies in SLE. J. Exp. Med 203: 553–561. [PMC free article] [PubMed] [Google Scholar]
28. Tiller T, Busse CE, and Wardemann H. 2009. Cloning and expression of murine Ig genes from single B cells. J. Immunol. Methods 350: 183–193. [PubMed] [Google Scholar]
29. Ho IY, Bunker JJ, Erickson SA, Neu KE, Huang M, Cortese M, Pulendran B, and Wilson PC. 2016. Refined protocol for generating monoclonal antibodies from single human and murine B cells. J. Immunol. Methods 438: 67–70. [PMC free article] [PubMed] [Google Scholar]
30. Davis CW, Jackson KJL, McElroy AK, Halfmann P, Huang J, Chennareddy C, Piper AE, Leung Y, Albariño CG, Crozier I, Ellebedy AH, Sidney J, Sette A, Yu T, Nielsen SCA, Goff AJ, Spiropoulou CF, Saphire EO, Cavet G, Kawaoka Y, Mehta AK, Glass PJ, Boyd SD, and Ahmed R. 2019. Longitudinal Analysis of the Human B Cell Response to Ebola Virus Infection. Cell 177: 1566–1582.e17. [PMC free article] [PubMed] [Google Scholar]
31. Yates AD, Achuthan P, Akanni W, Allen J, Allen J, Alvarez-Jarreta J, Amode MR, Armean IM, Azov AG, Bennett R, Bhai J, Billis K, Boddu S, Marugán JC, Cummins C, Davidson C, Dodiya K, Fatima R, Gall A, Giron CG, Gil L, Grego T, Haggerty L, Haskell E, Hourlier T, Izuogu OG, Janacek SH, Juettemann T, Kay M, Lavidas I, Le T, Lemos D, Martinez JG, Maurel T, McDowall M, McMahon A, Mohanan S, Moore B, Nuhn M, Oheh DN, Parker A, Parton A, Patricio M, Sakthivel MP, Abdul Salam AI, Schmitt BM, Schuilenburg H, Sheppard D, Sycheva M, Szuba M, Taylor K, Thormann A, Threadgold G, Vullo A, Walts B, Winterbottom A, Zadissa A, Chakiachvili M, Flint B, Frankish A, Hunt SE, IIsley G, Kostadima M, Langridge N, Loveland JE, Martin FJ, Morales J, Mudge JM, Muffato M, Perry E, Ruffier M, Trevanion SJ, Cunningham F, Howe KL, Zerbino DR, and Flicek P. 2020. Ensembl 2020. Nucleic Acids Res. 48: D682–D688. [PMC free article] [PubMed] [Google Scholar]
32. Church DM, Schneider VA, Graves T, Auger K, Cunningham F, Bouk N, Chen H-C, Agarwala R, McLaren WM, Ritchie GRS, Albracht D, Kremitzki M, Rock S, Kotkiewicz H, Kremitzki C, Wollam A, Trani L, Fulton L, Fulton R, Matthews L, Whitehead S, Chow W, Torrance J, Dunn M, Harden G, Threadgold G, Wood J, Collins J, Heath P, Griffiths G, Pelan S, Grafham D, Eichler EE, Weinstock G, Mardis ER, Wilson RK, Howe K, Flicek P, and Hubbard T. 2011. Modernizing reference genome assemblies. PLoS Biol. 9: e1001091. [PMC free article] [PubMed] [Google Scholar]
33. Yates A, Beal K, Keenan S, McLaren W, Pignatelli M, Ritchie GRS, Ruffier M, Taylor K, Vullo A, and Flicek P. 2015. The Ensembl REST API: Ensembl Data for Any Language. Bioinformatics 31: 143–145. [PMC free article] [PubMed] [Google Scholar]
34. Giudicelli V, Chaume D, and Lefranc MP. 2005. IMGT/GENE-DB: A comprehensive database for human and mouse immunoglobulin and T cell receptor genes. Nucleic Acids Res. 33: 256–261. [PMC free article] [PubMed] [Google Scholar]
35. Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ. 1990. Basic local alignment search tool. J. Mol. Biol 215: 403–410. [PubMed] [Google Scholar]
36. Stalker J 2004. The Ensembl Web Site: Mechanics of a Genome Browser. Genome Res. 14: 951–955. [PMC free article] [PubMed] [Google Scholar]
37. Murphy K, and Weaver C. 2017. Janeway’s Immunobiology, 9th ed Garland Science, Taylor & Francis Group, LLC, New York. [Google Scholar]
38. Vander Heiden JA, Yaari G, Uduman M, Stern JNH, O’connor KC, Hafler DA, Vigneault F, and Kleinstein SH. 2014. PRESTO: A toolkit for processing high-throughput sequencing raw reads of lymphocyte receptor repertoires. Bioinformatics 30: 1930–1932. [PMC free article] [PubMed] [Google Scholar]
39. Ye J, Ma N, Madden TL, and Ostell JM. 2013. IgBLAST: an immunoglobulin variable domain sequence analysis tool. Nucleic Acids Res. 41: 34–40. [PMC free article] [PubMed] [Google Scholar]
40. Gupta NT, Vander Heiden JA, Uduman M, Gadala-Maria D, Yaari G, and Kleinstein SH. 2015. Change-O: A toolkit for analyzing large-scale B cell immunoglobulin repertoire sequencing data. Bioinformatics 31: 3356–3358. [PMC free article] [PubMed] [Google Scholar]
41. Gupta NT, Adams KD, Briggs AW, Timberlake SC, Vigneault F, and Kleinstein SH. 2017. Hierarchical Clustering Can Identify B Cell Clones with High Confidence in Ig Repertoire Sequencing Data. J. Immunol 198: 2489–2499. [PMC free article] [PubMed] [Google Scholar]
42. Lefranc MP, Pommié C, Ruiz M, Giudicelli V, Foulquier E, Truong L, Thouvenin-Contet V, and Lefranc G. 2003. IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev. Comp. Immunol 27: 55–77. [PubMed] [Google Scholar]
43. Kouadjo KE, Nishida Y, Cadrin-Girard JF, Yoshioka M, and St-Amand J. 2007. Housekeeping and tissue-specific genes in mouse tissues. BMC Genomics 8: 127. [PMC free article] [PubMed] [Google Scholar]
44. Treutlein B, Brownfield DG, Wu AR, Neff NF, Mantalas GL, Espinoza FH, Desai TJ, Krasnow MA, and Quake SR. 2014. Reconstructing lineage hierarchies of the distal lung epithelium using single-cell RNA-seq. Nature 509: 371–375. [PMC free article] [PubMed] [Google Scholar]
45. Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM, Hao Y, Stoeckius M, Smibert P, and Satija R. 2019. Comprehensive Integration of Single-Cell Data. Cell 177: 1888–1902.e21. [PMC free article] [PubMed] [Google Scholar]
46. Vallania F, Tam A, Lofgren S, Schaffert S, Azad TD, Bongen E, Haynes W, Alsup M, Alonso M, Davis M, Engleman E, and Khatri P. 2018. Leveraging heterogeneity across multiple datasets increases cell-mixture deconvolution accuracy and reduces biological and technical biases. Nat. Commun 9. [PMC free article] [PubMed] [Google Scholar]
47. Bult CJ, Blake JA, Smith CL, Kadin JA, Richardson JE, Anagnostopoulos A, Asabor R, Baldarelli RM, Beal JS, Bello SM, Blodgett O, Butler NE, Christie KR, Corbani LE, Creelman J, Dolan ME, Drabkin HJ, Giannatto SL, Hale P, Hill DP, Law M, Mendoza A, McAndrews M, Miers D, Motenko H, Ni L, Onda H, Perry M, Recla JM, Richards-Smith B, Sitnikov D, Tomczuk M, Tonorio G, Wilming L, and Zhu Y. 2019. Mouse Genome Database (MGD) 2019. Nucleic Acids Res. 47: D801–D806. [PMC free article] [PubMed] [Google Scholar]
48. Yuan M, Wu NC, Zhu X, Lee C-CD, So RTY, Lv H, Mok CKP, and Wilson IA. 2020. A highly conserved cryptic epitope in the receptor-binding domains of SARS-CoV-2 and SARS-CoV. Science (80-. ). eabb7269. [PMC free article] [PubMed] [Google Scholar]
49. Sheehan KCF, Lai KS, Dunn GP, Bruce AT, Diamond MS, Heutel JD, Dungo-Arthur C, Carrero JA, White JM, Hertzog PJ, and Schreiber RD. 2006. Blocking Monoclonal Antibodies Specific for Mouse IFN- α / β Receptor Subunit 1 (IFNAR-1) from Mice Immunized by In Vivo Hydrodynamic Transfection. J. Interf. Cytokine Res. 26: 804–819. [PubMed] [Google Scholar]
50. Tai W, He L, Zhang X, Pu J, Voronin D, Jiang S, Zhou Y, and Du L. 2020. Characterization of the receptor-binding domain (RBD) of 2019 novel coronavirus: implication for development of RBD protein as a viral attachment inhibitor and vaccine. Cell. Mol. Immunol . [PMC free article] [PubMed] [Google Scholar]
51. Ju B, Zhang Q, Ge J, Wang R, Sun J, Ge X, Yu J, Shan S, Zhou B, Song S, Tang X, Yu J, Lan J, Yuan J, Wang H, Zhao J, Zhang S, Wang Y, Shi X, Liu L, Zhao J, Wang X, Zhang Z, and Zhang L. 2020. Human neutralizing antibodies elicited by SARS-CoV-2 infection. Nature 10.1038/s41586-020-2380-z(2020). [PubMed] [CrossRef] [Google Scholar]
52. Wang C, Li W, Drabek D, Okba NMA, van Haperen R, Osterhaus ADME, van Kuppeveld FJM, Haagmans BL, Grosveld F, and Bosch B-J. 2020. A human monoclonal antibody blocking SARS-CoV-2 infection. Nat. Commun 11: 2251. [PMC free article] [PubMed] [Google Scholar]
53. Cao Y, Su B, Guo X, Sun W, Deng Y, Bao L, Zhu Q, Zhang X, Zheng Y, Geng C, Chai X, He R, Li X, Lv Q, Zhu H, Deng W, Xu Y, Wang Y, Qiao L, Tan Y, Song L, Wang G, Du X, Gao N, Liu J, Xiao J, Su X-D, Du Z, Feng Y, Qin C, Qin C, Jin R, and Xie XS. 2020. Potent neutralizing antibodies against SARS-CoV-2 identified by high-throughput single-cell sequencing of convalescent patients’ B cells. Cell 1–12. [PMC free article] [PubMed] [Google Scholar]
54. Shi R, Shan C, Duan X, Chen Z, Liu P, Song J, Song T, Bi X, Han C, Wu L, Gao G, Hu X, Zhang Y, Tong Z, Huang W, Liu WJ, Wu G, Zhang B, Wang L, Qi J, Feng H, Wang F-S, Wang Q, Gao GF, Yuan Z, and Yan J. 2020. A human neutralizing antibody targets the receptor binding site of SARS-CoV-2. Nature . [PubMed] [Google Scholar]
55. Yang ZY, Werner HC, Kong WP, Leung K, Traggiai E, Lanzavecchia A, and Nabel GJ. 2005. Evasion of antibody neutralization in emerging severe acute respiratory syndrome coronaviruses. Proc. Natl. Acad. Sci. U. S. A 102: 797–801. [PMC free article] [PubMed] [Google Scholar]
56. Iwasaki A, and Yang Y. 2020. The potential danger of suboptimal antibody responses in COVID-19. Nat. Rev. Immunol 20: 339–341. [PMC free article] [PubMed] [Google Scholar]
57. Sia SF, Yan LM, Chin AWH, Fung K, Choy KT, Wong AYL, Kaewpreedee P, Perera RAPM, Poon LLM, Nicholls JM, Peiris M, and Yen HL. 2020. Pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature 10.1038/s41586-020-2342-5. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
-