Skip to main content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Cell Stress Chaperones. 2022 Sep; 27(5): 545–560.
Published online 2022 Aug 11. doi: 10.1007/s12192-022-01291-z
PMCID: PMC9485526
PMID: 35951259

Prophylactic role of olive fruit extract against cigarette smoke–induced oxidative stress in Sprague–Dawley rats

Urwa Tariq,1,2 Masood Sadiq Butt,corresponding author1 Imran Pasha,1 and Muhammad Naeem Faisal3
Author information Article notes Copyright and License information PMC Disclaimer

Associated Data

Data Availability Statement

Abstract

Cigarette smoke exposure increases the production of free radicals leading to initiation of several pathological conditions by triggering the oxidative stress and inflammatory cascade. Olive fruit owing to its unique phytochemical composition possesses antioxidant, immune modulatory, and anti-inflammatory potential. Considering the compositional alterations in olive fruits during ripening, the current experimental trail was designed to investigate the prophylactic role of green and black olives against the oxidative stress induced by cigarette smoke exposure in rats. Purposely, rats were divided into five different groups: NC (negative control; normal diet), PC [positive control; normal diet + smoke exposure (SE)], drug (normal diet + SE + citalopram), GO (normal diet + SE + green olive extract), and BO (normal diet + SE + black olive extract). Rats of all groups were exposed to cigarette smoke except “NC” and were sacrificed for collection of blood and organs after 28 days of experimental trial. The percent reduction in total oxidative stress by citalopram and green and black olive extracts in serum was 29.72, 58.69, and 57.97%, respectively, while the total antioxidant capacity increased by 30.78, 53.94, and 43.98%, accordingly in comparison to PC. Moreover, malondialdehyde (MDA) was reduced by 29.63, 42.59, and 45.70% in drug, GO, and BO groups, respectively. Likewise, green and black olive extracts reduced the leakage of hepatic enzymes in sera, alkaline phosphatase (ALP) by 23.44 and 25.80% and 35.62 and 37.61%, alanine transaminase (ALT) by 42.68 and 24.39% and 51.04 and 35.41%, and aspartate transaminase (AST) by 31.51 and 16.07% and 40.50 and 27.09% from PC and drug group, respectively. Additionally, olive extracts also maintained the antioxidant pool, i.e., superoxide dismutase, catalase, and glutathione in serum. Furthermore, histological examination revealed that olive extracts prevented the cigarette smoke–induced necrosis, pyknotic alterations, and congestion in the lung, hepatic, and renal parenchyma. Besides, gene expression analysis revealed that olive extracts and citalopram decreased the brain and lung damage caused by stress-induced upregulation of NRF-2 and MAPK signaling pathways. Hence, it can be concluded that olives (both green and black) can act as promising antioxidant in alleviating the cigarette smoke–induced oxidative stress.

Keywords: Oxidative stress, Cigarette smoke, Antioxidants, Olives, Extract, Prophylactic

Introduction

Cigarette smoking (CS) has been identified as the biggest public health catastrophe of the twentieth century. It is very difficult to avoid CS exposure despite of advanced legislation regarding smoking restrictions (Vallance et al. 2018). Human beings get exposed to cigarette smoke via few distinct routes, i.e., mainstream, sidestream, secondhand, and thirdhand smoke (Kumar et al. 2015). Disease burden attributed to cigarette smoke either mainstream or secondhand smoke (SHS) exposure is substantial, leading to 7 million deaths/annum and 6.3% of total disability adjusted life-years (WHO 2017), while these deaths are expected to exceed up to 10 million/annum by year 2030 (Singh and Kathiresan 2015). According to estimations of the World Health Organization, 1 billion smokers contribute to 0.88 million deaths associated with SHS exposure only, i.e., of individuals who had never smoked in their lives ever (Yousuf et al. 2020).

CS is a highly complex mixture of more than 5000 chemicals including at least 250 toxic chemicals and 69 carcinogens (Vermehren et al. 2020). Inhalation of polluted air exposes individuals to toxic constituents of CS, which is the major pathway of CS-induced pathological conditions (Na et al. 2020). Each CS puff contains 1015 free radicals that cause damage to macro- and micro-molecules of the body systems particularly the brain, lungs, liver, and kidneys. The major cigarette smoke free radicals are nitric oxide (NO−) and O−2 that combine with each other for the formation of peroxynitrite (Hasan et al. 2020). The accumulation of reactive oxygen species/reactive nitrogen species (ROS/RNS) in various body tissues might occur resultant to elevated oxidant generation, decreased antioxidant defense pool, or failure to recover oxidative damages (Butt et al. 2021). Higher or elevated oxidative stress results in dysfunction of mitochondria which leads to the free radical production and oxidative stress (OS) cycle exacerbation (Cobley et al. 2018).

Olive tree (Olea europaea L.) and its products are very special to mankind because of emphasis on its use in religious as well as historical texts and its utilization as a component in various traditional folk medicines (Uylaşer and Yildiz 2014). The olive tree is one of the oldest known trees in the world (Talhaoui et al. 2018). Olive fruit extract has been known to reduce body weight (Georgakouli et al. 2016), diabetes (Laaboudi et al. 2016), cholesterol (Fki et al. 2005), and inflammation (Na et al. 2020). Antioxidant properties of olive pulp extract and its polyphenols were investigated in comparison to renowned antioxidant vitamin C by analyzing H2O2 scavenging and iron reduction capacity. All tested components showed significant reducing capacities. Protective influence of pulp extract against lipid peroxidation has also been explored (Nadour et al. 2012). All these health benefits of olives are attributed to the biological activities of polyphenols and other bioactive components present therein including tyrosol, hydroxytyrosol, oleuropein, and anthocyanins. Olives can be eaten after removing the hard central pits either unripened green fruit or fully ripened black fruit (Johnson et al. 2018). Ripening and development of olive fruit are combination of physiological and biochemical events (Gouvinhas et al. 2017). During ripening, essential chemical shifts occur inside the fruit which are related to synthesis of important organic substances as well as altered enzymatic activities (Giacometti et al. 2018).

Smokers are more prone to get psychiatric disorders or mental health suffering than non-smokers or people having no-smoke exposure. Cigarette smoke induces the depressive-like symptoms in Sprague–Dawley rats that was confirmed by behavioral, biochemical, cellular, and molecular level analysis in our previous study (Tariq et al. 2021). Oxidative stress is a major causative factor behind the occurrence of structural and functional alterations in brain during depression (Black et al. 2015). Many studies have reported that excessive generation of ROS and decreased antioxidant pool are responsible for brain perturbations. The hypothesis about the involvement of oxidative stress in progression of depression is generally known as “oxidative stress hypothesis of depressive disorders” (Muraro et al. 2019; Butt et al. 2021). To testify this hypothesis, the current study was planned. Therefore, the similar treatment plan was followed to compare the effect that either the citalopram (most common antidepressant) or olives improve the CS-induced oxidative stress and which of the treatment variable is more efficient. Moreover, the expression of Nrf-2 signaling pathway was observed as Nrf-2 pathway is a redox-sensitive transcription factor controlling the release of various antioxidant enzymes in the body (Buendia et al., 2016). Hence, it would give the clear idea about the extent of oxidative stress induced. Previous studies have reported that Nrf-2 pathway activation is regulated by the mitogen-activated protein kinase (MAPK) pathway and promotes the release of cytoprotective enzymes by activating the Nrf-2 pathway (Liang et al. 2018; Zhou et al. 2021). Hence, to observe the interlinked mechanism, both MAPK and Nrf-2 pathways were considered for tissue analysis from the lungs and brain.

Materials and methods

Olive fruit extract preparation

Extract from green and black olives was prepared using fresh olive fruits procured from Barani Agriculture Research Institute, Chakwal, Pakistan. The olive fruits were harvested in mid-October (Green/unripened olives) and end of November (black/ripened). Extracts were prepared according to the method elaborated in our previous work (Tariq et al. 2021).

Animal study

Before the initiation of animal trail, approval from the “bioethics committee” of the University of Agriculture, Faisalabad, was taken and the instructions about the animal handling were carefully followed. Fifty Sprague–Dawley rats (200–250 g) were housed in different chambers at the well-lighted and aerated animal room of the National Institute of Food Science and Technology, University of Agriculture, Faisalabad. Rats were kept under light/dark cycle for 7 days at relative humidity (50 ± 10%) and constant room temperature (25 ± 2 °C) for acclimatization, prior to start of experimental trial. After 1 week of acclimatization, the rats were randomly divided into five groups and were provided with cigarette smoke and treatments as described in Fig. 1. The treatments such as olive extracts and citalopram were administered orally via gavage once a day for consecutive 28 days.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig1_HTML.jpg

a Experimental model, b set-up for cigarette smoke

Cigarette smoke exposure

Rats were exposed to cigarette smoke in specialized enclosed glass chamber (Tariq et al. 2021). The side stream smoke was generated in the chamber by coupling the burnt cigarette at one whole of the glass chamber, while in another whole on the opposite side of chamber, a sucker was attached to suck the cigarette smoke inside the chamber. Rats were exposed to cigarette smoke for half an hour twice a day with the time gap of 4 h the first exposure and the other. The lid of chamber was removed after burning of each cigarette (~ 5–6 min) and the rats were exposed to ambient air for 60 s prior to burning of next cigarette stick.

Blood sampling and decapitation

After completion of 28-day trial, rats were decapitated by cervical dislocation. Blood was collected in heparin containing vials for sera collection. Blood was centrifuged at 15,000 rpm for 15 min at 4 °C to separate serum. Specific organs like the brain and lungs were detached for analysis of genetic expression and the liver and kidney were detached and stored in 10% formalin solution to examine histological anomalies.

Liver stress biomarkers

Alanine aminotransferase, alkaline phosphatase, and serum bilirubin levels were measured through automatic chemical analyzer using commercial kits (CLIA; Cat # EKU09786 and Cat # EKN43353).

Kidney stress biomarkers

Serum creatinine and urea were estimated using commercial ELISA kits (Afify et al. 2018).

Antioxidants

Antioxidants, i.e., superoxide dismutase, catalase, and glutathione in serum, were examined by following the protocols mentioned below.

Superoxide dismutase

Initially, sera was gently mixed with 2-(4-iodophenyl)-3-(4-nitrophenol)-5-phenyltetrazolium chloride. Afterwards, xanthine oxidase was added to the reaction mixture. Absorbance was observed at 505 nm and the results were expressed as U/mL (Bahrami et al. 2016).

Catalase

Catalase level in sera was estimated according to the method of Hadwan (2018). The reaction solution contained H2O2 (5.9 mM), phosphate buffer (50 mM, pH 7), and 0.1 mL of enzyme sample. The reaction was initiated by addition of samples to enzyme extract and the absorbance was observed at 240 nm.

Glutathione (GSH)

Glutathione content in sera was estimated according to Ellman’s reaction (Ren et al. 2019). Accordingly, sera was well-mixed with 260 µL assay buffer (pH 8.1 mM EDTA, 0.1 M sodium phosphate) and 5 µL of Ellman’s reagent (5,5′-dithiobis-(2-nitrobenzoic acid). Mixture was incubated at room temperature for 15 min. The absorbance was measured at 412 nm.

Determination of malondialdehyde (MDA)

Malondialdehyde content was estimated as the marker of lipid peroxidation by mixing the deproteinized sera with thiobarbituric acid (0.9%, w/v). The absorbance was measured at 532 nm (Biala et al. 2017).

Total antioxidant capacity (TAC) and total oxidative stress (TOS)

TAC and TOS levels in sera were measured by calorimetric method (Erel 2004, 2005). For TAC assay, acetate buffer as reagent 1 (pH 5.8) and the ABTS [2,2′‐azinobis‐(3‐ethylbenzothiazoline‐6‐sulfonic acid)] radical as reagent 2 were used. Initially, 225 µL reagent 1 was mixed with 0.5 µL serum sample and incubated for 30 s; absorbance was measured at 420 nm. Afterwards, 20 µL reagent 2 (30 mM, pH 3.6) was added and mixed with the samples and absorbance was measured at 420 nm. The TAC values were obtained by taking difference of first absorbance taken before addition of reagent 2 and the second taken after adding it. Standard curve was prepared by using trolox as standard.

For TOS assay, reagent 1 was prepared by mixing 150 µM xylenol orange, 140 mM NaCl, and 1.35 M glycerol in 25 mM H2SO4 solution making the reagent’s pH 1.75. Likewise, reagent 2 was prepared by mixing 5 mM ferrous ion and 10 mM o-dianisidine in 25 mM H2SO4. At first step, 225 µL reagent 1 was mixed with 35 µL of serum sample and absorbance was observed at 560 nm. Afterwards, 11 µL reagent 2 was added to sample mixture and absorbance was measured at 560 nm. TOS values were calculated by taking difference of first absorbance taken before addition of reagent 2 and the second reading taken after adding reagent 2. Standard curve was prepared by using H2O2 as standard.

Histopathological examination

To evaluate the impact of cigarette smoke on histological architecture, organs including the lungs, liver, and kidneys were stored in 10% formalin solution soon after their detachment from the experimental rats. Tissues of each organ were mounted on glass slides after cutting then into 5-µm thick slices via microtome. The mounted sections were stained by hematoxylin–eosin and periodic acid-Schiff, and after settling down, the histological alterations were observed under the light microscope (MCX 100, Micros Austria).

Gene expression

Gene expression in the cDNAs prepared from lungs and brain tissue homogenates was quantified via quantitative real-time PCR (qRT-PCR) using the ROX Mater Mix/Maxima Cyber Green in iQ5 Bio-Rad System. During the performance of PCR procedure, the template denaturation was done at 95 °C for 15 s, while the annealing temperature was maintained at 59 °C for 30 s and extension period was set at 94 °C for 15 s for 40 cycles. The data obtained via PCR was analyzed using 2*(-ΔΔct) method (Tariq et al. 2021). The base pair sequences of specified primers used are shown in Table ​Table11.

Table 1

Primer sequence used for qRT-PCR analysis

GeneSense primersAntisense primers
Beta-actinTATCGTCATCCATGGCGAACTGCGAGTACAACCTTCTTGCAGC
Keap-1AGAACTCCTCCTCCCCGAAGCATGTGATGAACGGGGCAGT
Nrf-2CAAATCCATGTCCTGCTGGGACTCCGACTAGCCATTGACGC
Nef-1GGAGTGGCAGGCCAGTCTTACTTGTCCCGTCCCTAGGTC
MAPK-8CTGCTGTCTGTATCCGAGGCCTCAGCATCCGGTCTCTTCG
TRAF-4AGGTGTCGCAGAAGCGGTGCGACTACAAGTTCCTGGAGAAGC
TRAF-6GGCGCCTAGTAAGACAGGACGGCGCCTAGTAAGACAGGAC

Statistical analysis

The data obtained after all the analysis were handled using Microsoft Excel (Version 365) and statistical analysis was conducted using Statistix 8.1 software. To testify the statistical difference (p < 0.05), one-way analysis of variance was employed while means were compared through Tukey’s post hoc test.

Results

Hepatic stress biomarkers

Statistical analysis (Fig. 2) revealed significant variation for AST, ALT, and ALP among all experimental groups while non-significant difference was detected for total bilirubin. Lowest levels of ALP, ALT, AST, and total bilirubin were recorded in normal diet–fed rats NC; however, their highest values were recorded in citalopram-treated rats with CS exposure in drug trailed by CS-exposed rats in PC. Percent decrement by green olive extract (GO) in ALP, ALT, AST, and bilirubin from drug and PC was 35.62 and 23.44%, 51.04 and 42.68%, 40.50 and 31.51%, and 13.33 and 7.14%, respectively. Nevertheless, percent decrease corresponding to black olive extract (BO) in ALP, ALT, AST, and bilirubin from drug and PC was estimated as 37.61 and 25.80%, 35.04 and 24.39%, 27.09 and 16.07%, and 15.56 and 9.52%, respectively.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig2_HTML.jpg

Hepatic stress biomarkers of experimental rats. Bars with different letters varied significantly. a Alanine transaminase, b aspartate transaminase, c alkaline phosphatase, d bilirubin

Total antioxidant capacity (TAC) and total oxidative stress (TOS)

Statistical analysis to TAC and TOS (Fig. 3a, ​,b)b) reveals significant variation between all experimental groups. Mean serum levels for TAC were found lowest in CS-exposed rats in PC, while maximum in control rats NC. Citalopram and olive extract–treated groups showed a significant elevation in TAC. However, the effect was non-significant to NC, in both green and black olive extract–treated groups GO and BO than citalopram-treated group drug. Contrary to this, the highest value of TOS was recorded in PC followed by drug, BO, GO, and NC.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig3_HTML.jpg

a, b Total antioxidant capacity and total oxidative stress of experimental rats, a TAC, b TOS; c, d renal stress biomarkers of experimental rats, c urea, d creatinine; bars with different letters varied significantly

Renal stress biomarkers

Means pertaining to urea levels (Fig. 3c, d) showed maximum concentration in citalopram-treated rats “drug” as 59 ± 2.89 mg/dL followed by CS-exposed rats in PC, green olive extract–treated rats with CS in GO, and black olive extract–treated rats with CS in BO in comparison to control NC. Percent reduction noted by green and black olive extracts compared to PC and drug was 11 and 35% and 17 and 40%, respectively. Regarding creatinine levels, highest values were noted in citalopram-treated rats, while no momentous difference was observed in PC, GO, and BO when compared with NC. These results depict that CS exposure had no effect in alteration of serum creatinine levels.

Antioxidants

Statistical analysis (Fig. 4) for serum-specific antioxidant enzymes including SOD, CAT, and GSH shows significant differences among all experimental groups. Mean values elucidate a reduction in antioxidant enzymes, i.e., SOD, CAT, and GSH in CS-exposed rats (PC) in comparison to control rats (NC). However, citalopram and green and black olive treatment momentously enhanced these enzyme concentrations in sera, more efficiently by green olive extract in GO than BO and drug, respectively.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig4_HTML.jpg

Serum-specific oxidative stress markers of experimental rats. Bars with different letters varied significantly. a Superoxide dismutase, b catalase, c glutathione, d MDA

Malondialdehyde (MDA)

Statistical analysis (Fig. 4) for serum MDA showed significant difference among all experimental groups. Increased MDA levels were recorded in CS-exposed rats (PC) when compared with control rats (NC). Nonetheless, citalopram and green and black olive treatment showed momentous reduction in MDA concentration in sera for drug, GO, and BO, respectively.

Histological examination

Histological examination of lung tissues (Fig. 5) revealed that in normal diet–fed rats (NC), the pulmonary parenchyma was normal in appearance. Alveolar spaces were normal; however, at few spaces, mild degree of congestion was present. Unlike this, in smoke-exposed rats (PC), the architecture of pulmonary parenchyma indicated moderate to severe pneumonic changes. Irregular alveolar lumen was observed. Moreover, inflammatory and giant cells were seen at certain regions. In citalopram-treated rats (drug), mild degree of congestion and few inflammatory cells were observed. Treatment with green olive extract (GO) restored the normal architecture of pulmonary parenchyma with mild congestion at few places. Nonetheless, in black olive extract–treated rats (BO) normal appearance of pulmonary parenchyma and alveolar spaces alongside mild congestion with pyknotic nuclei were observed.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig5_HTML.jpg

Histopathological indications of lung parenchyma (H&E 10 ×). (NC) Negative control, (PC) positive control, (drug) standard drug, (GO) green olive, (BO) black olive

Histological examination of hepatic parenchyma (Fig. 6) revealed that in normal diet–fed rats (NC), the hepatic parenchyma was normal in appearance. Sinusoidal spaces were normal and the hepatocytes arranged in hepatic cords. Nuclei were also normal in appearance, whereas in smoke-exposed rats (PC), mild to moderate degree vacuolar degeneration and necrotic changes were present. Moreover, mild congestion and infiltration were also observed. Likewise, in citalopram-treated rats (drug), moderate degree of necrotic changes was present indicated by condensed and pyknotic nuclei of hepatocytes and sinusoidal congestion. In green olive extract–treated rats (GO), mild degree of vacuolar degradation was noted; however, hepatocytes were arranged in hepatic cords and necrotic changes were absent. Nonetheless, black olive extract treatment (BO) preserved normal parenchymal architecture as well as preserved sinusoidal spaces though mild infiltration and congestion were observed.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig6_HTML.jpg

Histopathological indications of hepatic parenchyma (H&E 40 ×). (NC) Negative control, (PC) positive control, (drug) standard drug, (GO) green olive, (BO) black olive

Figure 7 shows the representative images of kidney tissues of all experimental groups. For the kidneys in normal diet–fed rats (NC), renal parenchyma was normal in appearance. Urinary space in glomerulus and nuclei of tubular epithelial cell were normal having nucleolus and chromatin material. No proteinaceous material was found; however, mild congestion was noted. Unlike control group, renal parenchyma in smoke-exposed rats (PC) showed damage in epithelial cells alongside moderate degree of congestion and tubular necrosis. However, in citalopram-treated rats (drug), moderate to severe degree of congestion in renal parenchyma was observed. Moreover, inflammation of epithelial cells and pyknotic changes in renal nuclei were also noted. In case of green olive extract–treated rats (GO), no indication of necrosis and congestion was depicted; however, mild epithelial damage was observed, while in black olive–treated rats (BO), urinary space in glomerulus was normal. Nonetheless, mild degree of pyknotic nuclei and epithelial damage were seen in certain regions.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig7_HTML.jpg

Histopathological indications of renal parenchyma (H&E 40 ×). (NC) Negative control, (PC) positive control, (drug) standard drug, (GO) green olive, (BO) black olive

Gene expression analysis

Nrf-2 signaling pathway

Nrf-2 (NF-E2-related factor 2) plays pivotal role in regulating the expression of cellular stress–driven oxidative and inflammation. Expression levels of Keap-1, Nef-1, and Nrf-2 were evaluated in brain tissue and lung tissues for Nrf-2 signaling pathway and results depicted in Fig. 8 reveal that the expression levels of Keap-1, Nef-1, and Nrf-2 in PC were upregulated significantly in comparison to NC. However, the expression levels of Keap-1, Nef-1, and Nrf-2 in drug, GO, and BO, respectively, were significantly downregulated.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig8_HTML.jpg

Expression of Nrf-2 pathway genes, a brain tissue and b lung tissues; (NC) negative control, (PC) positive control, (drug) standard drug, (GO) green olive, (BO) black olive

MAPK downstream JNK pathway

Mitogen-activated protein kinase (MAPK) regulates the family of proteins involved in cell differentiation, proliferation, and cell death. Expression levels of MAPK-8, TRAF-4, and TRAF-6 were analyzed in brain and lung tissue for MAPK downstream JNK pathway. Expression levels of MAPK-8, TRAF-4, and TRAF-6 genes were significantly upregulated (Fig. 9) in PC in comparison to NC, whereas expression levels of MAPK-8, TRAF-4, and TRAF-6 genes were significantly downregulated in drug, GO, and BO, respectively.

An external file that holds a picture, illustration, etc. Object name is 12192_2022_1291_Fig9_HTML.jpg

Expression of MAPK downstream JNK pathway genes, a brain tissue and b lung tissues; (NC) negative control, (PC) positive control, (drug) standard drug, (GO) green olive, (BO) black olive

Discussion

Evidence are increasing with passage of time that CS exposure increases the production of free radicals in the body leading to initiation of several pathological conditions such as depletion of antioxidant reserves and hence increase in oxidative stress and inflammation cascade. The current experimental trail was designed to investigate the prophylactic role of green and black olives against the oxidative stress induced by one of the most common and deadly environmental pollutants “cigarette smoke” exposure. The current study shows that oxidative stress induced by citalopram and CS exposure adversely affected the functioning of hepatocytes and hence, caused leakage of hepatic enzymes from liver cytosol to blood stream. These outcomes also reveal that green olive extract is more potent in ameliorating oxidative stress–induced adverse effects on liver functioning. Findings of the current study are in harmony with Ilgin et al. (2020) who confirmed the hepatotoxic effects of different doses of citalopram (5, 10, and 20 mg/kg) and reported increased serum ALT, AST, and bilirubin levels consequent to all dosages. Citalopram is extensively metabolized by the liver enzymes mainly via cytochrome P450, and the toxic intermediates of citalopram metabolism unfavorably cause alteration in cytochrome P450 system functioning (Ng et al. 2019). Moreover, ROS generation by citalopram ingestion targets the mitochondrial and lysosomal membranes of hepatocytes and leads to damage in sub-organelles by inducing oxidative stress, which in turn initiates the cycle of further ROS generation and hence, accelerates hepatotoxicity (Ahmadian et al., 2017). Regarding the liver damage caused by CS exposure, CS caused rise in serum ALP, AST, ALT, and total bilirubin concentration by propagating the lipid peroxidation which damages the hepatocytic cell membrane (Alsalhen and Abdalsalam 2014). This lipid peroxidation might occur due to the nitrosative and oxidative stress induction by CS and its components which leads to alteration in hepatic protein structures and their functionality. Treatment with olive extract significantly restored the CS and citalopram-induced hepatotoxicity and these results are consistent with the outcomes of Maalej et al. (2017) who explored the protective effect of ethanolic olive fruit extract and its phenolic compounds, against hepato-renal toxicity induced by deltamethrin, in Wistar rats. They found that olive fruits and its bioactive components significantly restored the adverse impacts on serum ALT and AST levels and they suggested that this effect of olive fruit might be mediated by the antioxidant activity of OFE extract. Later, a group of researchers investigated the prophylactic potential of olive polyphenols against the antidepressant drug (fluoxetine) induced hepatotoxicity in rats. They found that olive polyphenols prevented the liver injury by restoring the liver functioning and by attenuating the fluoxetine induced oxidative stress, inflammation, and apoptosis of hepatocytes alongside increasing the antioxidant defense (Elgebaly et al. 2018). Olive polyphenols including oleuropein and hydroxytyrosol prevent hepatotoxicity by indirectly maintaining the structural integrity of hepatocytes, stopping the production of ROS and ultimately progression of oxidative stress (Ramírez-Expósito et al. 2021).

Intervention of olive fruit extracts showed significant diminution in renal stress markers in comparison to the rats receiving citalopram with CS exposure or CS exposure with treatment. Our findings are in corroboration with previous studies. A group of peers in their experiment testified that incubation of escitalopram to albino mice for 4 weeks significantly raised serum urea and creatinine levels in comparison to control rats (Saxena and Shahani 2017). High serum level of urea and creatinine indicates the improper functioning of the kidney and this might occur due to interference of citalopram with creatinine metabolism in rats. In a previous tryout, citalopram exposure to rats for 10, 20, and 30 days caused oxidative stress and raised the serum levels of urea and creatinine alongside the necrotic degradation of renal cells (Abdelmajeed 2009). Cigarette smoke contains several nephrotoxic components and its exposure for 4 h/day caused histological alteration in kidney tissues and disrupted their regular functioning (Alizadeh et al. 2020). Contrary to this, in the current experiment, non-momentous increase was recorded for serum creatinine levels, which is supported by the findings of Nemmar et al. (2013) who observed non-significant variation in serum markers of kidney after acute exposure to CS. They stated that this non-momentous variation does not confirm that CS had no adverse impact on kidney functioning as the classical kidney functioning tests like serum urea and creatinine might not detect the subtle kidney insults. Furthermore, Huang et al. (2016) reported an association between increased homocysteine (HCY) levels consequent to CS and glomerulosclerosis. They reported that CS damages the kidney tissues via two pathways: firstly by increasing ROS and ultimately higher HCY plasma levels and secondly by inducing inflammation and increase in cytokine production which activates the pyridoxal phosphatase enzyme in liver that leads to series of reactions including disrupted HCY metabolic pathway. Increased HCY promotes vicious circle of inflammatory processes directly linked to renal deterioration. Prophylactic role of olive extracts found in the current study is supported by Maalej et al. (2017). They found that olive fruits and its bioactive components significantly restored the adverse impacts on serum urea and creatinine and reduced the complications associated with decreased glomerular filtration rate. They suggested that this effect of olive fruit might be mediated by the antioxidant activity of OFE extract. Likewise, the protective effect of olive fruit and its polyphenols, i.e., oleuropein and hydroxytyrosol, has been found against gentamicin-included nephrotoxicity (Ahmadvand et al. 2016; Tavafi et al. 2012).

Antioxidants act as the first line of defense against the toxic effects associated with free radicals and oxidative stress. Many studies have reported that CS exposure shifts the redox balance towards the oxidative side by enhancing the ROS/RNS levels (Manafa et al. 2017, Mohod et al. 2014, Pangkahila and Weta 2020). Catalase, SOD, and GSH impart vital role in maintaining the cellular integrity from the hallmarks of ROS/RNS-induced oxidative stress and lipid peroxidation. Superoxide dismutase acts as the first line of defense against the excessive ROS. SOD converts these free radicals to H2O2 and reduces the oxidant-induced toxic effects. Reduced levels of SOD have been found to be associated with induction of several pathological conditions (Younus 2018). CS contains semiquinone and quinone that raise the level of superoxide radicals and hence, cause the reduction of SOD content (Olson et al. 2021; Ramesh et al. 2015). Resultant to increased levels of H2O2, catalase gets activated and detoxifies the excessive H2O2 in order to prevent the body from further damage due to oxidative stress. Consistent exposure to CS leads to increase in production of free radicals up to the level that catalase remains not enough able to scavenge those radicals and hence starts to deplete leading to lipid peroxidation (Aspera-Werz et al. 2018). On the other hand, glutathione not only helps in direct scavenging of free radicals but also plays a vital role in repairing of damaged cells consequent to stress/lipid peroxidation (Mohod et al. 2014). Hence, decline in GSH content after CS exposure clearly indicated the elevated lipid peroxidation (Fratta Pasini et al. 2012; Meisgen et al. 2014). Results of the current study also depict decline in antioxidant defense of rats following to CS exposure for 4 weeks.

The current outcomes revealed that citalopram and green and black olive extract counteracted the CS-mediated reduction in antioxidant enzymes. These outcomes are in corroboration with the findings, reporting that citalopram (5 and 10 mg/kg) significantly restored GSH and CAT declined in sleep deprivation–induced stressed mice (Garg and Kumar 2008). The authors suggested the restoration effect due to antioxidant potential of citalopram as it was also found to be associated with diminishing lipid peroxidation. Regarding the protective effects of olive extracts, results are supported by Serreli et al. (2017) who observed that olive pulp extract significantly counteracted the stress-induced alterations in redox status by inhibiting the ROS production and enhancing the cellular antioxidant pool. They speculated this effect of olive extract due to ability of its main phytochemicals including oleuropein, hydroxytyrosol, and apigenin to scavenge free radicals and mitigate the toxic effects of reaction metabolites. Likewise, a group of peers explored the ameliorating effect of oleuropein and hydroxytyrosol in glioma model of Wistar rats and found that both oleuropein and hydroxytyrosol momentously enhanced serum concentration of SOD, CAT, and GSH (Martínez-Martos et al. 2014). Moreover, olive extracts increased the serum antioxidant enzyme concentration more efficiently than citalopram drug which depicts great potential of olive extracts in mitigating the oxidative stress damages than antidepressant drug. Likewise, for MDA (the biomarker to indicate lipid peroxidation), current outcomes are in accordance with the findings of Pangkahila and Weta (2020) who reported increased plasma MDA in rats after exposure to CS for 14 days. Likewise, Alizadeh et al. (2020) reported that exposure to CS (4 h/day) for 2 weeks significantly raised serum MDA concentration in CS-exposed mice. Group of peers explored the influence of plant polyphenols and antioxidants in ameliorating CS-induced increased lipid peroxidation and found that plant polyphenols significantly counteracted the CS-induced MDA elevation when compared with non-treated CS-exposed rats (Dwiyanti et al. 2020). Hence, higher MDA levels in CS-exposed rats reveal strong association of CS with oxidative stress and lipid peroxidation.

In another conduct, Martinez-Martos and his colleagues explored the individual and combined antioxidant potential effect of hydroxytyrosol and oleuropein in an animal model of glioma. They observed that hydroxytyrosol and oleuropein in combination imparted more pronounced effect in inhibition of lipid peroxidation than their individual supplementation. They concluded from these outcomes that hydroxytyrosol and oleuropein reduced lipid peroxidation due to their antioxidant potential and ability to modify the redox status (Martínez-Martos et al. 2014). Similarly, Ristagno et al. (2012) also reported the antioxidant behavior of hydroxytyrosol in a dose-dependent manner in ameliorating lipid peroxidation and oxidative stress in diabetic rat model. These findings support the outcomes of the current study which showed that green and black olive extracts showed prophylactic role against CS-induced lipid peroxidation due to good quantity of antioxidant polyphenols.

Regarding the TAC-TOS levels in serum, results of current study indicate the induction of oxidative stress after smoke exposure and citalopram treatment which is supported by the previous findings of Cui et al. (2020). They explicated the effect of acute CS exposure (1 h/day for 7 days) to Sprague–Dawley rats and elucidated that acute CS exposure also caused significant reduction in antioxidant capacity of rats by declining the levels of enzymatic and non-enzymatic antioxidant pool which indicates the occurrence of oxidative stress. Concerning the higher oxidative stress in citalopram-treated group, these findings are in line with Magni et al. (2017). They explored the adverse influences of two major antidepressants fluoxetine and citalopram and found that both drugs adversely affected the redox balance even after consumption for 4 days. Likewise, treatment of depressive patients with escitalopram caused reduction in oxidative stress and enhanced antioxidant capacity when compared with baseline (before treatment) conditions (Cumurcu et al. 2009). This study confirms the findings of the current study that citalopram, to some extent, portrays positive effect in ameliorating the hallmarks of oxidative stress but not up to required levels. Moreover, green and black olive extract momentously attenuated the CS and citalopram-induced oxidative stress might be due to their high antioxidant capacity. These outcomes are supported by the investigations of Mahmoudi et al. (2015) who reported that olive polyphenols, i.e., oleuropein and hydroxytyrosol, significantly enhanced the plasma antioxidant capacity in stressed lactating mothers and their pups. Moreover, Almatroodi et al. (2020) evaluated the antioxidant and anti-inflammatory effect of 70% ethanolic extract of green olive fruit’s pulp in mice. They reported that administration of olive extract considerably enhanced the antioxidant capacity of experimental rats, stressed by CCL4 infusions. They suggested that olive fruit reduced the oxidative stress by regulating the antioxidant enzymes and inflammatory cytokines. Similar results have also been observed by Rabiei et al. (2018) and Hassimotto and Lajolo (2011) who found the positive influence of olive phenols on TAC and TOS. Thus, it can be implied that olive fruit extracts possess ameliorative effects on rats by restoring TAC and mitigating TOS, owing to their antioxidant and anti-inflammatory polyphenols.

Allied to biochemical assessment, histopathological alterations in the lung, liver, and kidney tissues were also observed to explore the extent and type of damage to organ’s portfolio. Regarding histological examination of lung parenchyma, observations of the current study are quite in agreement with the findings of Wawryk-Gawda et al. (2020). They reported irregular alveoli, inflammation, and pyknosis in pulmonary parenchyma of Wistar rats after cigarette smoke exposure for 30 days. Likewise, Tsuji et al. (2013) reported that cigarette exposure for 2 weeks damages bronchial epithelial cells and increased alveolar macrophages. Regarding protective impact of citalopram treatment observed in the current experiment, these findings are in consistent with Sherkawy et al. (2018) who reported that fluoxetine treatment (10 mg/kg) for 21 days ameliorated the ovalbumin-induced distorted pulmonary structure and inflammatory infiltration in rat model. As fluoxetine falls under the category of SSRIs, its outcomes are comparable with citalopram effectiveness. Preventive influence of olive fruit extracts might be mediated by its phenolic components. One of researcher’s groups, Impellizzeri et al. (2011), investigated the protective effects of oleuropein aglycone (hydrolytic product of oleuropein) in carrageenan-induced stress in mice model. They reported marked reduction of inflammatory infiltration and necrotic alteration in pulmonary parenchyma of oleuropein aglycone–treated mice. Moreover, Zhao et al. (2020) reported that anthocyanins (cyanidin-3-glucosid) administration considerably attenuated silica-induced inflammatory cell infiltration in pulmonary parenchyma.

The alterations observed in hepatic parenchyma and the histological findings of the current study are quite in agreement with the earlier observations of Machado-Junior et al. (2020). The researchers reported that hepatic parenchyma and hepatic cords were normal in negative control rats, while exposure to cigarette smoke resulted in alterations in hepatic parenchyma including appearance of necrosis, inflammation, sinusoidal congestion, and pyknotic nuclei. However, they also observed that treatment with quercetin preserved the hepatic parenchyma and necrotic changes. Regarding alteration in hepatic parenchyma of citalopram-treated rats, the current observations are supported by Ahmadian et al. (2017) who indicated altered architecture of hepatic parenchyma, inflammatory cell infiltration, and shrinkage of hepatocytes after citalopram treatment. They also noted that treatment with multiple antioxidants alleviated the citalopram-included hepatocytic alterations. One of the researcher’s groups, Almatroodi et al. (2020), investigated the effect of olive fruit extract on hepatic histological parameter in CCL4-induced hepatotoxic mice. In hepatotoxic mice, edema, sinusoidal congestion and infiltration of hepatocytes, and damaged hepatic cords were observed, while olive extract potentially ameliorated such alterations and hepatocyte appearance was found very close to hepatic parenchyma of negative control. Likewise, Elgebaly et al. (2018) reported that olive leaf extract and olive oil polyphenols including oleuropein, hydroxytyrosol, and anthocyanins prevented SSRI (fluoxetine)-induced hepatic nuclear pyknosis, sinusoidal dilation, nuclear vacuolization, and cell infiltration.

For renal parenchyma, the current findings agree with Ramalingam et al. (2019) who reported that in negative control rats, no prominent alterations in renal parenchyma were observed. However, damage in epithelial lining was noted in renal parenchyma after nicotine exposure for 28 days. The current histological findings regarding citalopram treatment are in accordance with Aggarwal et al. (2019) who indicated toxic effects of SSRI (fluoxetine) antidepressants on renal parenchyma of experimental rats. They observed dilated renal tubules, and condensed renal nuclei with disturbed cellular orientation after treatment with fluoxetine for 4 weeks. Like the current study, previous studies validate the renoprotective role of olive polyphenols. Maalej et al. (2017) reported that olive fruit extract considerably recovered the deltamethrin-induced disruption in renal architecture, severe glomerular congestion, and tubular death in experimental rats. Likewise, Mahmoudi et al. (2015) observed positive potential of olive polyphenols, i.e., hydroxytyrosol and oleuropein, in ameliorating bisphenol A-induced glomerular and tubular necrosis and epithelial damage in renal parenchyma of rats. In the nutshell, the histological examination of the lung, liver, and kidney tissues revealed that olive extract at both ripening stages and citalopram efficiently prevented cigarette smoke–induced moderate to severe necrosis, pyknotic alterations, and congestion.

Gene expression analysis in brain and lung tissues was performed to investigate the expression levels of genes involved in cellular stress including MAPK-8, TRAF-4, TRAF-6, Keap-1, Nef-1, and Nrf-2. It has been investigated in previous researches that cigarette smoke exposure exacerbates the production of ROS/RNS (Hasan et al. 2020; Wartenberg et al. 2020). Brain cells are considered more susceptible to ROS/RNS (Cobley et al. 2018). Production of ROS/RNS targeted various signaling pathways in brain and lung tissues. In the current experiment, stress pathway, i.e., MAPK downstream JNK pathway, was activated by CS exposure evaluated by increased expression of MAPK-8, TRFA-4, and TRAF-6. Likewise, Nrf-2 pathway was also upregulated by CS exposure in smoke-exposed positive control rats (PC) than normal diet–fed rats (NC). Previous studies have confirmed that concurrent exposure to stress elevated the Nrf-2 family which in turn activates release of antioxidants and prevents from inflammation (Ahmed et al. 2017). The possible mechanism behind the activation of this protective Nrf-2 pathway in CS-exposed rats might involve the declined antioxidant pool in tissues obvious from biochemical results. However, treatment with citalopram and green and black olive extract reserved the mRNA expression of the above-mentioned pathways in drug, GO, and BO, respectively. These results are supported by previous studies which showed that olive fruit and its polyphenols reduced the levels of inflammatory cytokines (Park et al. 2017; Talhaoui et al. 2018), calcium influx, which is activated initially and starts the cycle of activation of other stress cycles like MAPK and Nrf-2 pathways (Hassan Gilani et al. 2005; Marchetti et al. 2015). Moreover, elevated expression of antiapoptotic genes was observed which elaborates the proapoptotic effects induced by activated MAPK (Maalej et al., 2017). Likewise, positive influence of antidepressant drugs in maintaining oxidative stress markers is supported by the previous findings (Hernandez et al. 2013; Shaik et al. 2019). The protective effects of olive extracts and standard drug in regulating signaling cascade might be triggered by inhibiting the ROS production due to their antioxidant and anti-inflammatory potential.

In summary, all the findings of the current work elaborate that olive fruits at both degrees of ripeness portray antioxidant and anti-inflammatory potential and thus alleviate the hallmarks of CS-induced oxidative stress. Moreover, when compared to the standard antidepressant drugs, the prophylactic role of olive fruit extracts at unripened (green) stage was observed more reliable. Furthermore, the outcomes of histological and genetic expressions also endorsed the preventive potential of olive extracts. Hence, it can be concluded that green and black olives–based interventions may protect against oxidative stress–induced cellular insults.

Acknowledgements

The authors are thankful to the Higher Education Commission, Pakistan, for providing funds under the project “Indigenous 5000 Fellowship Program.” The authors are also thankful to Barani Agriculture Research Institute (BARI) Chakwal, for supplying the olive fruits and to the Faculty of Food, Nutrition and Home Sciences, University of Agriculture, for providing the technical support.

Funding

The work has been sponsored by the Higher Education Commission under the project “Indigenous 5000 Fellowship Program.”

Data availability

The authors confirm that data supporting the findings of current study is available within the manuscript.

Declarations

Conflict of interest

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • Abdelmajeed NA. Oxidative tissue damage induced by citalopram in rat different organs. Res J Med Medical Sci. 2009;4:580–586. [Google Scholar]
  • Abdul-Razaq SN, Ahmed BM. Effect of cigarette smoking on liver function test and some other related parameters. Zanco J Med Sci (zanco J Med Sci) 2013;17:556–562. doi: 10.15218/zjms.2013.0048. [CrossRef] [Google Scholar]
  • Afify AE-MM, El-Beltagi HS, Fayed SA, El-Ansary AE. Beneficial and potent effect of olive leaves extract on hyperglycemic state, kidney and liver function in STZ-induced type 2 diabetes mellitus. Fresen Environ Bull. 2018;27:3733–3739. [Google Scholar]
  • Aggarwal A, Jethani S, Rohatgi R, Kalra J (2019) Effect of Fluoxetine on Kidney of Albino Rats-A Histological Study. J Clin Diagn Res 13 [PMC free article] [PubMed]
  • Ahmadian E, Eftekhari A, Fard JK, Babaei H, Nayebi AM, Mohammadnejad D, Eghbal MA. In vitro and in vivo evaluation of the mechanisms of citalopram-induced hepatotoxicity. Arch Pharmacal Res. 2017;40:1296–1313. doi: 10.1007/s12272-016-0766-0. [PubMed] [CrossRef] [Google Scholar]
  • Ahmadvand H, Bagheri S, Tamjidi-Poor A, Cheraghi M, Azadpour M, Ezatpour B, Moghadam S, Shahsavari G, Jalalvand M. Biochemical effects of oleuropein in gentamicin-induced nephrotoxicity in rats. ARYA Atherosclerosis. 2016;12:87. [PMC free article] [PubMed] [Google Scholar]
  • Ahmed SMU, Luo L, Namani A, Wang XJ, Tang X. Nrf2 signaling pathway: pivotal roles in inflammation. Biochimica et Biophysica Acta (BBA) -Mol Basis Dis. 2017;1863:585–597. doi: 10.1016/j.bbadis.2016.11.005. [PubMed] [CrossRef] [Google Scholar]
  • Alizadeh J, Jaffarzadeh Z, Angali KA, Ahmadizadeh M. Exposure of cigarette smoke aggravates noise induced kidney damage. J Renal Inj Prev. 2020;10:e12–e12. doi: 10.34172/jrip.2021.12. [CrossRef] [Google Scholar]
  • Almatroodi SA, Almatroudi A, Anwar S, Yousif Babiker A, Khan AA, Alsahli MA, Rahmani AH. Antioxidant, anti-inflammatory and hepatoprotective effects of olive fruit pulp extract: in vivo and in vitro study. J Taibah Univ Sci. 2020;14:1660–1670. doi: 10.1080/16583655.2020.1848761. [CrossRef] [Google Scholar]
  • Alsalhen KS, Abdalsalam RD. Effect of cigarette smoking on liver functions: a comparative study conducted among smokers and non-smokers male in El-beida City, Libya. Int Curr Pharm J. 2014;3:291–295. doi: 10.3329/icpj.v3i7.19077. [CrossRef] [Google Scholar]
  • Aspera-Werz RH, Ehnert S, Heid D, Zhu S, Chen T, Braun B, Sreekumar V, Arnscheidt C, Nussler AK (2018) Nicotine and cotinine inhibit catalase and glutathione reductase activity contributing to the impaired osteogenesis of SCP-1 cells exposed to cigarette smoke. Oxidative Med Cell Longev 2018 [PMC free article] [PubMed]
  • Bahrami S, Shahriari A, Tavalla M, Azadmanesh S, Hamidinejat H (2016) Blood levels of oxidant/antioxidant parameters in rats infected with Toxoplasma gondii. Oxidative Medicine and Cellular Longevity 2016 [PMC free article] [PubMed]
  • Biala G, Pekala K, Boguszewska-Czubara A, Michalak A, Kruk-Slomka M, Budzynska B. Behavioral and biochemical interaction between nicotine and chronic unpredictable mild stress in mice. Mol Neurobiol. 2017;54:904–921. doi: 10.1007/s12035-016-9701-0. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Black CN, Bot M, Scheffer PG, Cuijpers P, Penninx BW. Is depression associated with increased oxidative stress? A systematic review and meta-analysis. Psychoneuroendocrinology. 2015;51:164–175. doi: 10.1016/j.psyneuen.2014.09.025. [PubMed] [CrossRef] [Google Scholar]
  • Buendia I, Michalska P, Navarro E, Gameiro I, Egea J, Leon R. Nrf2–ARE pathway: an emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases. Pharmacol Ther. 2016;157:84–104. doi: 10.1016/j.pharmthera.2015.11.003. [PubMed] [CrossRef] [Google Scholar]
  • Butt MS, Tariq U, Naz A, Rizwan M. Neuroprotective effects of oleuropein: recent developments and contemporary research. J Food Biochem. 2021;45:e13967. doi: 10.1111/jfbc.13967. [PubMed] [CrossRef] [Google Scholar]
  • Chen Z, Wang D, Liu X, Pei W, Li J, Cao Y, Zhang J, An Y, Nie J, Tong J. Oxidative DNA damage is involved in cigarette smoke-induced lung injury in rats. Environ Health Prev Med. 2015;20:318–324. doi: 10.1007/s12199-015-0469-z. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Cimen B, Gumus CB, Cetin I, Ozsoy S, Aydin M, Cimen L. The effects of escitalopram treatment on oxidative/antioxidative parameters in patients with depression. Klinik Psikofarmakoloji Bülteni-Bull Clin Psychopharmacol. 2015;25:272–279. doi: 10.5455/bcp.20150215102247. [CrossRef] [Google Scholar]
  • Cobley JN, Fiorello ML, Bailey DM. 13 reasons why the brain is susceptible to oxidative stress. Redox Biol. 2018;15:490–503. doi: 10.1016/j.redox.2018.01.008. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Cui Y, Liu KW, Ip MS, Liang Y, Mak JC (2020) Protective effect of selegiline on cigarette smoke-induced oxidative stress and inflammation in rat lungs in vivo. Ann Transl Med 8 [PMC free article] [PubMed]
  • Cumurcu BE, Ozyurt H, Etikan I, Demir S, Karlidag R. Total antioxidant capacity and total oxidant status in patients with major depression: impact of antidepressant treatment. Psychiatry Clin Neurosci. 2009;63:639–645. doi: 10.1111/j.1440-1819.2009.02004.x. [PubMed] [CrossRef] [Google Scholar]
  • Dwiyanti H, Setyawati R, Krisnansari D. 2020. Effect of feeding coconut sugar-mix coffee rich in antioxidants on blood pressure, serum SOD and MDA of sprague dawley rats. Pages 012070. IOP Conf Ser: Earth Environ Sci: IOP Publishing
  • Dwiyanti H, Setyawati R, Krisnansari D. 2020. Effect of feeding coconut sugar-mix coffee rich in antioxidants on blood pressure, serum SOD and MDA of sprague dawley rats. Pages 012070. IOP Conf Ser: Earth Environ Sci: IOP Publishing
  • Elgebaly HA, Mosa NM, Allach M, El-Massry KF, El-Ghorab AH, Al Hroob AM, Mahmoud AM. Olive oil and leaf extract prevent fluoxetine-induced hepatotoxicity by attenuating oxidative stress, inflammation and apoptosis. Biomed Pharmacother. 2018;98:446–453. doi: 10.1016/j.biopha.2017.12.101. [PubMed] [CrossRef] [Google Scholar]
  • Erel O. A novel automated direct measurement method for total antioxidant capacity using a new generation, more stable ABTS radical cation. Clin Biochem. 2004;37:277–285. doi: 10.1016/j.clinbiochem.2003.11.015. [PubMed] [CrossRef] [Google Scholar]
  • Erel A new automated colorimetric method for measuring total oxidant status. Clin Biochem. 2005;38:1103–1111. doi: 10.1016/j.clinbiochem.2005.08.008. [PubMed] [CrossRef] [Google Scholar]
  • Fki I, Bouaziz M, Sahnoun Z, Sayadi S. Hypocholesterolemic effects of phenolic-rich extracts of Chemlali olive cultivar in rats fed a cholesterol-rich diet. Bioorg Med Chem. 2005;13:5362–5370. doi: 10.1016/j.bmc.2005.05.036. [PubMed] [CrossRef] [Google Scholar]
  • Fratta Pasini A, Albiero A, Stranieri C, Cominacini M, Pasini A, Mozzini C, Vallerio P, Cominacini L, Garbin U. Serum oxidative stress-induced repression of Nrf2 and GSH depletion: a mechanism potentially involved in endothelial dysfunction of young smokers. PLoS ONE. 2012;7:e30291. doi: 10.1371/journal.pone.0030291. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Garg R, Kumar A (2008) Possible role of citalopram and desipramine against sleep deprivation-induced anxiety like-behavior alterations and oxidative damage in mice. [PubMed]
  • Georgakouli K, Mpesios A, Kouretas D, Petrotos K, Mitsagga C, Giavasis I, Jamurtas AZ. The effects of an olive fruit polyphenol-enriched yogurt on body composition, blood redox status, physiological and metabolic parameters and yogurt microflora. Nutrients. 2016;8:344. doi: 10.3390/nu8060344. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Giacometti J, Milin Č, Giacometti F, Ciganj Z. Characterisation of monovarietal olive oils obtained from croatian cvs. drobnica and buza during the ripening period. Foods. 2018;7:188. doi: 10.3390/foods7110188. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Gouvinhas I, Machado N, Sobreira C, Domínguez-Perles R, Gomes S, Rosa E, Barros AI. Critical review on the significance of olive phytochemicals in plant physiology and human health. Mol. 2017;22:1986. doi: 10.3390/molecules22111986. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Hadwan MH. Simple spectrophotometric assay for measuring catalase activity in biological tissues. BMC Biochem. 2018;19:1–8. doi: 10.1186/s12858-018-0097-5. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Hasan F, Khachatryan L, Lomnicki S. Comparative studies of environmentally persistent free radicals on total particulate matter collected from electronic and tobacco cigarettes. Environ Sci Technol. 2020;54:5710–5718. doi: 10.1021/acs.est.0c00351. [PubMed] [CrossRef] [Google Scholar]
  • Hassan Gilani A, Khan A-U, Jabbar Shah A, Connor J, Jabeen Q. Blood pressure lowering effect of olive is mediated through calcium channel blockade. Int J Food Sci Nutr. 2005;56:613–620. doi: 10.1080/09637480500539420. [PubMed] [CrossRef] [Google Scholar]
  • Hassimotto NM, Lajolo FM. Antioxidant status in rats after long-term intake of anthocyanins and ellagitannins from blackberries. J Sci Food Agric. 2011;91:523–531. doi: 10.1002/jsfa.4216. [PubMed] [CrossRef] [Google Scholar]
  • Hernandez ME, Mendieta D, Pérez-Tapia M, Bojalil R, Estrada-Garcia I, Estrada-Parra S, Pavón L (2013) Effect of selective serotonin reuptake inhibitors and immunomodulator on cytokines levels: an alternative therapy for patients with major depressive disorder. Clin dev immunol 2013 [PMC free article] [PubMed]
  • Huang F, Chen J, Liu X, Han F, Cai Q, Peng G, Zhang K, Chen W, Wang J, Huang H. Cigarette smoking reduced renal function deterioration in hypertensive patients may be mediated by elevated homocysteine. Oncotarget. 2016;7:86000. doi: 10.18632/oncotarget.13308. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Ilgin S, Dagasan F, Donmez DB, Baysal M, EkLioglu OA. Evaluation of the hepatotoxic potential of citalopram in rats. J Fac Pharm Istanbul Univ. 2020;50:188–195. [Google Scholar]
  • Impellizzeri D, Esposito E, Mazzon E, Paterniti I, Di Paola R, Bramanti P, Morittu VM, Procopio A, Britti D, Cuzzocrea S. The effects of oleuropein aglycone, an olive oil compound, in a mouse model of carrageenan-induced pleurisy. Clin Nutr Res. 2011;30:533–540. doi: 10.1016/j.clnu.2011.02.004. [PubMed] [CrossRef] [Google Scholar]
  • Jaggi S, Yadav AS. Increased serum malondialdehyde levels among cigarette smokers. The Pharma Innovation. 2015;4:94. [Google Scholar]
  • Johnson R, Melliou E, Zweigenbaum J, Mitchell AE. Quantitation of oleuropein and related phenolics in cured Spanish-style green, California-style black ripe, and Greek-style natural fermentation olives. J Agric Food Chem. 2018;66:2121–2128. doi: 10.1021/acs.jafc.7b06025. [PubMed] [CrossRef] [Google Scholar]
  • Kumar SR, Davies S, Weitzman M, Sherman S. A review of air quality, biological indicators and health effects of second-hand waterpipe smoke exposure. Tob Control. 2015;24:i54–i59. doi: 10.1136/tobaccocontrol-2014-052038. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Laaboudi W, Ghanam J, Ghoumari O, Sounni F, Merzouki M, Benlemlih M. Hypoglycemic and hypolipidemic effects of phenolic olive tree extract in streptozotocin diabetic rats. Int J Pharm Pharm Sci. 2016;8:287–291. doi: 10.22159/ijpps.2016v8i12.14077. [CrossRef] [Google Scholar]
  • Liang F, Fang Y, Cao W, Zhang Z, Pan S, Xu X. Attenuation of tert-butyl hydroperoxide (t-BHP)-induced oxidative damage in HepG2 Cells by tangeretin: relevance of the Nrf2–ARE and MAPK signaling pathways. J Agri Food Chem. 2018;66:6317–6325. doi: 10.1021/acs.jafc.8b01875. [PubMed] [CrossRef] [Google Scholar]
  • Maalej A, Mahmoudi A, Bouallagui Z, Fki I, Marrekchi R, Sayadi S. Olive phenolic compounds attenuate deltamethrin-induced liver and kidney toxicity through regulating oxidative stress, inflammation and apoptosis. Food Chem Toxicol. 2017;106:455–465. doi: 10.1016/j.fct.2017.06.010. [PubMed] [CrossRef] [Google Scholar]
  • Machado-Junior PA, Araújo NP, Souza AB, Castro TF, Oliveira M, Costa GP, Matos NA, Vieira P, Talvani A, Bezerra FS (2020) Protective effects of quercetin on livers from mice exposed to long-term cigarette smoke. BioMed Res Int 2020 [PMC free article] [PubMed]
  • Magni S, Parolini M, Della Torre C, de Oliveira LF, Catani M, Guzzinati R, Cavazzini A, Binelli A. Multi-biomarker investigation to assess toxicity induced by two antidepressants on Dreissena polymorpha. Sci Total Environ. 2017;578:452–459. doi: 10.1016/j.scitotenv.2016.10.208. [PubMed] [CrossRef] [Google Scholar]
  • Mahmoudi A, Ghorbel H, Marrekchi R, Isoda H, Sayadi S. Oleuropein and hydroxytyrosol protect from bisphenol A effects in livers and kidneys of lactating mother rats and their pups'. Exp Toxicol Pathol. 2015;67:413–425. doi: 10.1016/j.etp.2015.04.007. [PubMed] [CrossRef] [Google Scholar]
  • Manafa P, Okafor C, Okeke C, Chukwuma G, Ibeh N, Ogenyi S, Nwene E, Aneke J. Assessment of superoxide dismutase activity and total antioxidant capacity in adult male cigarette smokers in Nnewi metropolis, Nigeria. J Med Res. 2017;3:23–26. doi: 10.31254/jmr.2017.3109. [CrossRef] [Google Scholar]
  • Marchetti C, Clericuzio M, Borghesi B, Cornara L, Ribulla S, Gosetti F, Marengo E, Burlando B (2015) Oleuropein-enriched olive leaf extract affects calcium dynamics and impairs viability of malignant mesothelioma cells. Evid-Based Complement Alternat Med 2015 [PMC free article] [PubMed]
  • Martínez-Martos JM, Mayas MD, Carrera P, de Saavedra JMA, Sánchez-Agesta R, Arrazola M, Ramírez-Expósito MJ. Phenolic compounds oleuropein and hydroxytyrosol exert differential effects on glioma development via antioxidant defense systems. j funct foods. 2014;11:221–234. doi: 10.1016/j.jff.2014.09.006. [CrossRef] [Google Scholar]
  • Meisgen T, Roemer E, Conroy LL, Hostens J, Vasquez M, Humeny A, Moehring M, Schlage WK, Kasper M. Cigarette-smoke-and age-dependent oxidative stress effects in rats. Beitr Tabakforschung Int/Contrib Tob Res. 2014;26:109–120. [Google Scholar]
  • Mohod K, Ninghot A, Ansari AK, Garg N. Circulating lipid peroxide and antioxidant status in cigarette smokers: an oxidative damage phenomena. IJHSR. 2014;4:61–62. [Google Scholar]
  • Muraro C, Dalla Tiezza M, Pavan C, Ribaudo G, Zagotto G, Orian L. Major depressive disorder and oxidative stress: in silico investigation of fluoxetine activity against ROS. Appl Sci. 2019;9:3631. doi: 10.3390/app9173631. [CrossRef] [Google Scholar]
  • Na X, Zhang L, Wang H, Tan M. Adverse effect assessment of fluorescent carbon dots in cigarette smoke. NanoImpact. 2020;19:100241. doi: 10.1016/j.impact.2020.100241. [CrossRef] [Google Scholar]
  • Nadour M, Michaud P, Moulti-Mati F. Antioxidant activities of polyphenols extracted from olive (Olea europaea) of chamlal variety. Appl Biochem Biotechnol. 2012;167:1802–1810. doi: 10.1007/s12010-012-9633-8. [PubMed] [CrossRef] [Google Scholar]
  • Nemmar A, Raza H, Subramaniyan D, Yasin J, John A, Ali BH, Kazzam EE. Short-term systemic effects of nose-only cigarette smoke exposure in mice: role of oxidative stress. Cell Physiol Biochem. 2013;31:15–24. doi: 10.1159/000343345. [PubMed] [CrossRef] [Google Scholar]
  • Ng QX, Yong CSK, Loke W, Yeo WS, Soh SYA. Escitalopram⁃ induced liver injury: a case report and review of literature. World J Hepatol. 2019;11:719. doi: 10.4254/wjh.v11.i10.719. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Olson KR, Gao Y, Straub KD. Oxidation of hydrogen sulfide by quinones: how polyphenols initiate their cytoprotective effects. Int J Mol Sci. 2021;22:961. doi: 10.3390/ijms22020961. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Pangkahila W, Weta IW (2020) Oral administration of melatonin increased superoxide dismutase and reduced malondialdehyde in male wistar rats (rattus norvegicus) induced by cigarette smoke. IJAAM (Indones J Anti-Aging Med) 4(1):33–35
  • Park J, Min J-S, Chae U, Lee JY, Song K-S, Lee H-S, Lee HJ, Lee S-R, Lee D-S. Anti-inflammatory effect of oleuropein on microglia through regulation of Drp1-dependent mitochondrial fission. J Neuroimmunol. 2017;306:46–52. doi: 10.1016/j.jneuroim.2017.02.019. [PubMed] [CrossRef] [Google Scholar]
  • Rabiei Z, Jahanbazi S, Alibabaei Z, Rafieian-Kopaei M. Antidepressant effects of oleuropein in male mice by forced swim test and tail suspension test. World Fam Med J: Inc Middle East J Fam Med. 2018;99:1–13. [Google Scholar]
  • Ramalingam A, Santhanathas T, Shaukat Ali S, Zainalabidin S. Resveratrol supplementation protects against nicotine-induced kidney injury. Int J Environ Res Public Health. 2019;16:4445. doi: 10.3390/ijerph16224445. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Ramesh T, Sureka C, Bhuvana S, Begum VH. Oxidative stress in the brain of cigarette smoke-induced noxiousness: neuroprotective role of Sesbania grandiflora. Metab Brain Dis. 2015;30:573–582. doi: 10.1007/s11011-014-9614-4. [PubMed] [CrossRef] [Google Scholar]
  • Ramírez-Expósito M, Carrera-González M, Mayas M, Martínez-Martos J. Gender differences in the antioxidant response of oral administration of hydroxytyrosol and oleuropein against N-ethyl-N-nitrosourea (ENU)-induced glioma. Food Res Int. 2021;140:110023. doi: 10.1016/j.foodres.2020.110023. [PubMed] [CrossRef] [Google Scholar]
  • Ren S-X, Zhang B, Lin Y, Ma D-S, Li H. Mechanistic evaluation of anti-arthritic activity of β-methylphenylalanine in experimental rats. Biomed Pharmacother. 2019;113:108730. doi: 10.1016/j.biopha.2019.108730. [PubMed] [CrossRef] [Google Scholar]
  • Ristagno G, Fumagalli F, Porretta-Serapiglia C, Orru A, Cassina C, Pesaresi M, Masson S, Villanova L, Merendino A, Villanova A. Hydroxytyrosol attenuates peripheral neuropathy in streptozotocin-induced diabetes in rats. J Agric Food Chem. 2012;60:5859–5865. doi: 10.1021/jf2049323. [PubMed] [CrossRef] [Google Scholar]
  • Saxena SC, Shahani L. ameliorative effect of broccoli powder on renal toxicity in mice caused by continuous exposure to escitalopram antidepressant drug. Int Res J Pharm. 2017;8:54–61. doi: 10.7897/2230-8407.0811217. [CrossRef] [Google Scholar]
  • Serreli G, Incani A, Atzeri A, Angioni A, Campus M, Cauli E, Zurru R, Deiana M. Antioxidant effect of natural table olives phenolic extract against oxidative stress and membrane damage in enterocyte-like cells. J Food Sci. 2017;82:380–385. doi: 10.1111/1750-3841.13613. [PubMed] [CrossRef] [Google Scholar]
  • Shaik AB, Shenoy S, Anupama V, Rao KM, Amuthan A. Antidepressants modulate behavioral, biochemical, and histological alterations induced by chronic aluminum chloride administration in wistar rats. J Pharmacol Pharmacother. 2019;10:16. doi: 10.4103/jpp.JPP_135_18. [CrossRef] [Google Scholar]
  • Sherkawy MM, Abo-Youssef AM, Salama AA, Ismaiel IE. Fluoxetine protects against OVA induced bronchial asthma and depression in rats. Eur J Pharmacol. 2018;837:25–32. doi: 10.1016/j.ejphar.2018.08.026. [PubMed] [CrossRef] [Google Scholar]
  • Singh CR, Kathiresan K. Effect of cigarette smoking on human health and promising remedy by mangroves. Asian Pac J Trop Biomed. 2015;5:162–167. doi: 10.1016/S2221-1691(15)30337-3. [CrossRef] [Google Scholar]
  • Talhaoui N, Trabelsi N, Taamalli A, Verardo V, Gómez-Caravaca AM, Fernández-Gutiérrez A, Arraez-Roman D (2018) Olea europaea as potential source of bioactive compounds for diseases prevention. Pages 389–411. Studies in natural products chemistry, vol. 57 Elsevier
  • Tariq U, Butt MS, Pasha I, Faisal MN. Neuroprotective effects of Olea europaea L. fruit extract against cigarette smoke-induced depressive-like behaviors in Sprague-Dawley rats. J Food Biochem. 2021;45:e14014. doi: 10.1111/jfbc.14014. [PubMed] [CrossRef] [Google Scholar]
  • Tavafi M, Ahmadvand H, Toolabi P (2012) Inhibitory effect of olive leaf extract on gentamicin-induced nephrotoxicity in rats [PubMed]
  • Tsuji H, Fujimoto H, Matsuura D, Nishino T, Lee KM, Yoshimura H. Comparison of biological responses in rats under various cigarette smoke exposure conditions. J Toxicol Pathol. 2013;26:159–174. doi: 10.1293/tox.26.159. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Uylaşer V, Yildiz G. The historical development and nutritional importance of olive and olive oil constituted an important part of the Mediterranean diet. Crit Rev Food Sci Nutr. 2014;54:1092–1101. doi: 10.1080/10408398.2011.626874. [PubMed] [CrossRef] [Google Scholar]
  • Vallance JK, Gardiner PA, Lynch BM, D’Silva A, Boyle T, Taylor LM, Johnson ST, Buman MP, Owen N. Evaluating the evidence on sitting, smoking, and health: is sitting really the new smoking? Am J Public Health. 2018;108:1478–1482. doi: 10.2105/AJPH.2018.304649. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Vermehren M, Wiesmann N, Deschner J, Brieger J, Al-Nawas B, Kämmerer P. Comparative analysis of the impact of e-cigarette vapor and cigarette smoke on human gingival fibroblasts. Toxicol in Vitro. 2020;69:105005. doi: 10.1016/j.tiv.2020.105005. [PubMed] [CrossRef] [Google Scholar]
  • Wartenberg M, Andrault P-M, Saidi A, Bigot P, Nadal-Desbarats L, Lecaille F, Lalmanach G. Oxidation of cathepsin S by major chemicals of cigarette smoke. Free Radical Biol Med. 2020;150:53–65. doi: 10.1016/j.freeradbiomed.2020.02.013. [PubMed] [CrossRef] [Google Scholar]
  • Wawryk-Gawda E, Chylińska-Wrzos P, Zarobkiewicz MK, Chłapek K, Jodłowska-Jędrych B. Lung histomorphological alterations in rats exposed to cigarette smoke and electronic cigarette vapour. Exp Ther Med. 2020;19:2826–2832. [PMC free article] [PubMed] [Google Scholar]
  • WHO (World Health Organization) (2017) Depression and other common mental disorders: global health estimates. World Health Organization. Report no (WHO/MSD/MER/2017.2)
  • Younus H. Therapeutic potentials of superoxide dismutase. Int J Health Sci. 2018;12:88. [PMC free article] [PubMed] [Google Scholar]
  • Yousuf H, Hofstra M, Tijssen J, Leenen B, Lindemans JW, van Rossum A, Narula J, Hofstra L. Estimated worldwide mortality attributed to secondhand tobacco smoke exposure, 1990–2016. JAMA Netw Open. 2020;3:e201177–e201177. doi: 10.1001/jamanetworkopen.2020.1177. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Zhao J, Ma J, Zhang Q, Tian J, Wang Y, Meng X. Cyanidin-3-glucoside attenuates silica-induced pulmonary inflammatory responses by modulating T cell immune responses and STAT1/STAT3 signaling. J Funct Foods. 2020;68:103911. doi: 10.1016/j.jff.2020.103911. [CrossRef] [Google Scholar]
  • Zhou Z, Zhou B, Chen H, Lu K, Wang Y. Oxidative stress activates the Nrf2-mediated antioxidant response and P38 MAPK pathway: a possible apoptotic mechanism induced by BDE-47 in rainbow trout (Oncorhynchus mykiss) gonadal RTG-2 cells. Environ Pollut. 2021;287:117341. doi: 10.1016/j.envpol.2021.117341. [PubMed] [CrossRef] [Google Scholar]
Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier
-