Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2019 May 28;7(2):46.
doi: 10.3390/vaccines7020046.

Bacterial Outer Membrane Vesicles (OMVs)-based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV

Mahmoud M Shehata  1 , Ahmed Mostafa  2   3 , Lisa Teubner  4 , Sara H Mahmoud  5 , Ahmed Kandeil  6 , Rabeh Elshesheny  7 , Renate Frantz  8 , Luigi La Pietra  9 , Stephan Pleschka  10 , Ahmed Osman  11 , Ghazi Kayali  12   13 , Trinad Chakraborty  14 , Mohamed A Ali  15 , Mobarak Abu Mraheil  16
Affiliations

Bacterial Outer Membrane Vesicles (OMVs)-based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV

Mahmoud M Shehata et al. Vaccines (Basel). .

Abstract

Vaccination is the most functional medical intervention to prophylactically control severe diseases caused by human-to-human or animal-to-human transmissible viral pathogens. Annually, seasonal influenza epidemics attack human populations leading to 290-650 thousand deaths/year worldwide. Recently, a novel Middle East Respiratory Syndrome Coronavirus emerged. Together, those two viruses present a significant public health burden in areas where they circulate. Herein, we generated a bacterial outer membrane vesicles (OMVs)-based vaccine presenting the antigenic stable chimeric fusion protein of the H1-type haemagglutinin (HA) of the pandemic influenza A virus (H1N1) strain from 2009 (H1N1pdm09) and the receptor binding domain (RBD) of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) (OMVs-H1/RBD). Our results showed that the chimeric antigen could induce specific neutralizing antibodies against both strains leading to protection of immunized mice against H1N1pdm09 and efficient neutralization of MERS-CoV. This study demonstrate that OMVs-based vaccines presenting viral antigens provide a safe and reliable approach to protect against two different viral infections.

Keywords: H1N1pdm; MERS-CoV; OMVs; influenza vaccine.

PubMed Disclaimer

Conflict of interest statement

The authors declare no conflict of interest.

Figures

Figure 1
Figure 1
Construction of pMP-H1/RBD and characterization of the secreted OMVs-H1/RBD. (a) Schematic representation of the outer-membrane vesicles (OMVs)-vaccination platform to combat MERS-CoV and pandemic 2009 H1N1 (H1N1pdm09). The target sequences of MERS-CoV (RBD, 720 bp, 240 aa) and H1N1pdm09 (HA) were amplified, purified, digested and ligated to pMPccdB vector. The ligated plasmids harboring the target sequences were transformed into bacteria and the secreted OMVs containing recombinant antigens were then purified for evaluation in mice. Abbreviations: NCR: Non-coding region, SP: Signal peptide, RBD: Receptor binding domain (MERS-CoV), L: Nucleotide sequence of peptide linker (GGTAGCGCCGGTAGCGCCGGA), HA1: Hemagglutinin 1, and HA2: Hemagglutinin 2. (b) Immunoblotting pattern of OMVs, extracted either from various control/non-transformed OMVs (C1, C2, and C3) (empty OMVs) or pMP-H1/RBD-transformed (OMVs-H1/RBD) DH10ß (S1-S6), against antiserum of swine HA1 antibody.
Figure 2
Figure 2
Immunostimulation of neutralizing antibodies against H1N1pdm2009 and MERS-CoV in mice. (a) Experimental timeline. (b) Hemagglutinin Inhibition (HAI) antibody titers against rgH1N1pdm09 in mice sera of vaccinated groups with OMVs-H1/RBD and inactivated H1N1pdm09 were monitored every two weeks in comparison to control PBS and OMVs-empty groups. Statistical changes marked by * p value < 0.05, ** p value < 0.01, *** p value < 0.001 and ns p value > 0.05 non-significant change. (c) Neutralization titer against MERS-CoV for mice sera vaccinated with inactivated MERS-CoV and OMVs-H1/RBD using plaque reduction neutralization (PRNT) assay. Statistical changes marked by * p value < 0.05, ** p value < 0.01, *** p value < 0.001 and ns p value > 0.05 non-significant change.
Figure 3
Figure 3
Plaque reduction neutralization (PRNT) from week 2 to week 8 in mice sera of vaccinated (a, d, and e) and control groups (b and c). (f) represents the MERS-CoV-positive control for the PRNT assay, cell negative control, and mice sera at zero time of the experiment.
Figure 4
Figure 4
OMVs-based vaccine efficacy following challenge infection. (a) Body weight loss of female BALB/c mice (6–8 weeks of age) infected intra-nasally with 105.5 TCID50 dose of Cal-H1N1pdm2009 strain. The body weight loss recorded up to 14 days p.i. and (b) Survival percentage at indicated time points (up to 14 days p.i.). Mice had to be euthanized when they lost ≥ 30% of their initial body weight.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Bhuyan G.S., Hossain M.A., Sarker S.K., Rahat A., Islam M.T., Haque T.N., Begum N., Qadri S.K., Muraduzzaman A.K., Islam N.N., et al. Bacterial and viral pathogen spectra of acute respiratory infections in under-5 children in hospital settings in Dhaka city. PLoS ONE. 2017;12:e0174488. doi: 10.1371/journal.pone.0174488. - DOI - PMC - PubMed
    1. The top 10 Causes of Death. [(accessed on 12 May 2019)]; Available online: https://www.who.int/news-room/fact-sheets/detail/the-top-10-causes-of-death.
    1. Troeger C., Forouzanfar M., Rao P.C., Khalil I., Brown A., Swartz S., Fullman N., Mosser J., Thompson R.L., Reiner R.C., et al. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of lower respiratory tract infections in 195 countries: a systematic analysis for the Global Burden of Disease Study 2015. Lancet Infect. Dis. 2017;17:1133–1161. doi: 10.1016/S1473-3099(17)30396-1. - DOI - PMC - PubMed
    1. Burden of Disease. [(accessed on 12 May 2019)]; Available online: https://www.who.int/influenza/surveillance_monitoring/bod/en/
    1. Potter C.W. A history of influenza. J. Appl. Microbiol. 2001;91:572–579. doi: 10.1046/j.1365-2672.2001.01492.x. - DOI - PubMed

LinkOut - more resources

-