Reduced expression of Dicer associated with poor prognosis in lung cancer patients

Yoko Karube; Hisaaki Tanaka; Hirotaka Osada; Shuta Tomida; Yoshio Tatematsu; Kiyoshi Yanagisawa; Yasushi Yatabe; Junichi Takamizawa; Shinichiro Miyoshi; Tetsuya Mitsudomi; Takashi Takahashi

doi:10.1111/j.1349-7006.2005.00015.x

Cancer Sci. 2005 Feb; 96(2): 111–115.

Published online 2005 Feb 21. doi: 10.1111/j.1349-7006.2005.00015.x

PMCID: PMC11158408

PMID: 15723655

Reduced expression of Dicer associated with poor prognosis in lung cancer patients

Yoko Karube,^1
,⁴ Hisaaki Tanaka,^1
,⁵ Hirotaka Osada,¹ Shuta Tomida,¹ Yoshio Tatematsu,¹ Kiyoshi Yanagisawa,^1
,⁵ Yasushi Yatabe,² Junichi Takamizawa,^1
,⁵ Shinichiro Miyoshi,⁴ Tetsuya Mitsudomi,³ and Takashi Takahashi^1
,⁵

Yoko Karube

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

⁴Department of Cardio Thoracic Surgery, Dokkyo University School of Medicine, 880 Kitakobayashi, Mibu‐machi, Shimotsuga‐gun, Tochigi 321–0293; and

Find articles by Yoko Karube

Hisaaki Tanaka

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

⁵Division of Molecular Carcinogenesis, Center for Neural Disease and Cancer, Nagoya University School of Medicine, 65 Tsurumai‐cho, Showa‐ku, Nagoya 466–8550, Japan

Find articles by Hisaaki Tanaka

Hirotaka Osada

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

Find articles by Hirotaka Osada

Shuta Tomida

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

Find articles by Shuta Tomida

Yoshio Tatematsu

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

Find articles by Yoshio Tatematsu

Kiyoshi Yanagisawa

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

⁵Division of Molecular Carcinogenesis, Center for Neural Disease and Cancer, Nagoya University School of Medicine, 65 Tsurumai‐cho, Showa‐ku, Nagoya 466–8550, Japan

Find articles by Kiyoshi Yanagisawa

Yasushi Yatabe

²Pathology and Molecular Diagnostics and

Find articles by Yasushi Yatabe

Junichi Takamizawa

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

⁵Division of Molecular Carcinogenesis, Center for Neural Disease and Cancer, Nagoya University School of Medicine, 65 Tsurumai‐cho, Showa‐ku, Nagoya 466–8550, Japan

Find articles by Junichi Takamizawa

Shinichiro Miyoshi

⁴Department of Cardio Thoracic Surgery, Dokkyo University School of Medicine, 880 Kitakobayashi, Mibu‐machi, Shimotsuga‐gun, Tochigi 321–0293; and

Find articles by Shinichiro Miyoshi

Tetsuya Mitsudomi

³Thoracic Surgery Aichi Cancer Center Hospital, 1–1 Kanokoden, Chikusa‐ku, Nagoya 464–0021;

Find articles by Tetsuya Mitsudomi

Takashi Takahashi

¹Division of Molecular Oncology, Aichi Cancer Center Research Institute; Departments of

⁵Division of Molecular Carcinogenesis, Center for Neural Disease and Cancer, Nagoya University School of Medicine, 65 Tsurumai‐cho, Showa‐ku, Nagoya 466–8550, Japan

Find articles by Takashi Takahashi

Author information Article notes Copyright and License information PMC Disclaimer

Abstract

Emerging evidence suggests that microRNA, which are well‐conserved, abundant and small regulatory RNA, may be involved in the pathogenesis of human cancers. We recently reported that expression of let‐7 was frequently reduced in lung cancers, and that reduced let‐7 expression was significantly associated with shorter patient survival. Two members of the double‐stranded RNA‐specific endonuclease family, Dicer and Drosha, convert precursor forms of microRNA into their mature forms using a stepwise process. In the present study, we examined expression levels of these genes in 67 non‐small cell lung cancer cases, and found for the first time that Dicer expression levels were reduced in a fraction of lung cancers with a significant prognostic impact on the survival of surgically treated cases. It should be noted that multivariate COX regression analysis showed that the prognostic impact of Dicer (P = 0.001) appears to be independent of disease stage (P = 0.001), while logistic regression analysis demonstrated that the higher incidence of reduced Dicer expression in poorly differentiated tumors remained significant even after correction for other parameters (P = 0.02). Given the fundamental and multiple biological roles of Dicer in various cellular processes, our results suggest the involvement of reduced Dicer expression in the development of lung cancers, thus warranting further investigations of the underlying mechanisms, which can be expected to enhance understanding of the molecular pathogenesis of this fatal cancer. (Cancer Sci 2005; 96: 111–115)

Introduction

Lung cancer is the leading cause of cancer‐related death in Japan, as it is in many other economically developed countries.¹^,² The mutation, amplification and epigenetic changes of various genes, which may eliminate the normal function of gene products, have been identified in lung cancers, suggesting that they may be involved in pathogenesis.⁽³⁾ In addition, emerging evidence suggests that microRNA, which constitute a well‐conserved and abundant class of approximately 22‐nucleotide regulatory RNA, could also be involved. We previously reported that the expression of let‐7 was frequently reduced in lung cancers, both in vitro and in vivo, and that reduced let‐7 expression was significantly associated with shorter patient survival.⁽⁴⁾ Furthermore, we were able to demonstrate that over‐expression of let‐7 resulted in significant inhibition of in vitro growth of lung cancer cells. In addition to our findings in lung cancers, a number of studies have dealt with microRNA alterations in other types of human cancers. These alterations include down‐regulation of miR15 and miR16 in chronic lymphocytic leukemia as well as of miR‐143 and miR‐145 in human colon cancers.⁵^,⁶ The biological functions of microRNA are not yet fully understood, but it has been suggested that they play a role in the coordination of cell proliferation and cell death during development, in addition to their involvement in stress resistance.⁷^,⁸^,⁹ This evidence appears to lend support to the notion that microRNA alterations could be involved in the genesis and/or progression of various human cancers.

A double‐stranded RNA (dsRNA)‐specific endonuclease converts precursor forms of microRNA into mature forms through a stepwise process, which includes the generation of ∼70nt pre‐microRNA with a characteristic hairpin structure from the longer nascent transcripts (pri‐microRNA), and further processing into its mature form.⁷^,⁸^,⁹ In humans, Dicer and Drosha are thought to collaborate in this stepwise processing of microRNA, with Drosha executing the initial step of microRNA processing in the nucleus,⁽¹⁰⁾ and the resultant premicroRNA being exported to the cytoplasm where they are cleaved by Dicer to generate the final products of ∼22nt.¹¹^,¹²^,¹³^,¹⁴^,¹⁵^,¹⁶

In this study, we posed a question as to whether expressions of Dicer and Drosha, which are essential for the processing of microRNA, are altered in lung cancers, and whether changes in the expression have any effect on clinicopathological features. To this end, we examined 67 non‐small cell lung cancer (NSCLC) cases, which had undergone potentially curative surgical resection, by means of real‐time RT‐PCR. We report here for the first time that the reduced expression of Dicer in a significant fraction of lung cancers was associated with shorter postoperative survival.

Materials and methods

Patients and tumor sample preparations.

NSCLC samples were obtained from 67 patients who underwent potentially curative resection at the Aichi Cancer Center Hospital (Nagoya, Japan) between January 1996 and January 1998. Approval from the institutional review board and the patients’ written informed consent were obtained. Stages were determined after pathologic evaluation of resected specimens according to the International System for Staging Lung Cancer, revised in 1997. The cohort consisted of 41 males and 26 females, with age at diagnosis ranging from 32 to 84 years (median age, 62 years). Thirty‐seven patients had stage I disease, 13 patients stage II and 17 patients stage III. There were 15 patients with poorly differentiated, 43 with moderately and nine patients with well‐differentiated tumors. Thirty‐eight patients were smokers, and the remaining 29 had never smoked. A surgical pathologist (Y.Y.) performed a gross examination of the tissue specimens immediately after surgical removal, and pieces of tumor tissue were carefully selected for maximum tumor content. Half of each piece was snap frozen in liquid nitrogen, followed by storage at −80°C until use, and the other half was fixed with prechilled acetone and embedded in paraffin for confirmation of tumor contents. Total RNA was isolated by means of the standard acid guanidinium isothiocyanate/cesium chloride procedure using ultracentrifugation.

Relative quantification by real‐time RT‐PCR analysis.

First‐strand cDNA were synthesized from total RNA using Moloney murine leukemia virus reverse transcriptase (M‐MLV RT) (Invitrogen, Carlsbad, CA, USA) and random hexamer primers (Roche Applied Science, Alameda, CA, USA). Real‐time quantitative PCR amplification of a cDNA template corresponding to 20 ng total RNA was performed using SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) in an ABI PRISM 7900‐HT (Applied Biosystems). PCR conditions were 50°C for 2 min, 95°C for 10 min, followed by 55 cycles of 95°C for 30 s, 65°C for 30 s, and 72°C for 30 s. Standard curves were plotted by using serially diluted cDNA of the BEAS2B lung epithelial cell line, and the expression level of the samples was normalized with that of 18S rRNA and expressed as a ratio of the normalized expression of the gene of interest in a mixture of the RNA of 38 normal lung tissues. Expression levels in this mixture of normal lung RNA were adopted as 1. The primer pairs used for Dicer were 5′‐GTACGACTACCACAAGTACTTC‐3′ and 5′‐ATAGTACACCTGCCAGACTGT‐3′, for Drosha, 5′‐GTGCTGTCCATGCACCAGATT‐3′ and 5′‐TGCATAACTCAACTGTGCAGG‐3′; and for 18S rRNA, 5′‐AATCAGGGTTCGATTCCGGA‐3′ and 5′‐CCAAGATCCAACTACGAGCT‐3′.

DNA methylation analysis of Dicer.

Extraction of genomic DNA from tissues was performed according to standard procedures. Genomic DNA were treated with the bisulfite conversion method as described in a previous study.⁽¹⁷⁾ After conversion, the promoter region of Dicer was amplified by PCR and every CpG site within the region was examined with direct sequencing for the presence of DNA methylation. The primer sequence was designed on the basis of the converted sense strand sequences without CpG sites 5′‐TTTATTTGGGTTTGTAGTAGT‐3′ and 5′‐AACCCTATCCAATCACAAACT‐3′. The PCR mixture contained 1 unit of Platinum Taq DNA polymerase (Invitrogen) together with 1 × PCR buffer, 2.5 mM of MgCl₂, 25 pmol of each primer, and 0.2 mM of dNTP. PCR conditions were 95°C for 5 min, followed by 40 cycles at 95°C for 30 s, at 56°C for 30 s, at 72°C for 45 s, and at 72°C for 5 min. The PCR products were gel extracted (QIAquick Gel Extraction Kit; Qiagen, Valencia, CA, USA) and sequenced directly with the aid of an ABI PRISM BigDye Terminator Cycle Sequencing Kit (Applied Biosystems).

Statistical analysis.

The following biostatistical analyses were performed with the STATA statistical package release 7.0 (STATA, College Station, TX, USA). The χ² goodness‐of‐fit test was used to analyze whether the distribution of expression levels at log₂ of Dicer or Drosha could be fitted to the normal distribution. Student's t‐test was employed to determine the best cut‐off value for separating two characteristic groups in terms of gene expression levels. The association between expression levels of Dicer and Drosha was analyzed by computing the Pearson correlation coefficient, and associations between various clinicopathologic characteristics and the expression levels of Dicer and Drosha were examined by means of Fisher's exact test. The Kaplan‐Meier estimates of overall survival time were compared by using the log‐rank test. Cox regression analysis of factors potentially related to survival was used to identify which independent factors might jointly have a significant effect on survival. All tests were two‐tailed, and the significance level was set at P < 0.05.

Results

Reduced expression of Dicer in NSCLC. We used real‐time RT‐PCR analysis to examine 67 NSCLC cases, which had undergone potentially curative resection, for Dicer and Drosha expression. We found that there was a significant correlation between Dicer and Drosha expression in NSCLC, with a Pearson correlation coefficient of 0.79 (P < 0.001; Fig. 1a). However, close inspection of the distributions of their expression disclosed a clear difference. A histogram of the expression of Dicer showed a frequency distribution with two prominent peaks at log₂ values from −1.6 to −1.4 and from 0.6 to 0.8 (Fig. 1B), which was in marked contrast to that of Drosha (Fig. 1C). We used the χ² goodness‐of‐fit test to determine whether the observed frequency distributions of expression of Dicer and Drosha could be fitted to the normal distribution. In the case of Dicer, it was clear that the data were not normally distributed (P < 0.001). The Student's t‐test was therefore used to identify the cut‐off value with the highest potential for discriminating two distinct groups in terms of Dicer expression. Patients could be divided most clearly and consistently into two groups with low and high expression of Dicer when the distribution threshold was set at −1.0 of the log₂ ratio of Dicer expression. In contrast to the findings for Dicer, the hypothesis that the distribution of Drosha follows a normal distribution pattern could not be rejected (P = 0.97). Accordingly, the median expression level (i.e. 1.1 of the log₂ value) was chosen as the threshold value to be used for further analysis.

An external file that holds a picture, illustration, etc.
Object name is CAS-96-111-g001.jpg

Open in a separate window

Figure 1

Histograms of distributions of non‐small cell lung cancers (NSCLC) according to their expression of double‐stranded RNA‐specific endonucleases mRNA. (A) Scattered plot analysis of expression levels of Dicer and Drosha. (B) Histogram of Dicer expression level at log₂ value in NSCLC. With the threshold set at −1.0 of log₂ value, patients were divided into two groups: low, with Dicer log₂ value expression <−1.0; and high, with Dicer log₂ value expression = −1.0. (C) Histogram of Drosha log₂ value expression level in NSCLC. With the threshold set at 1.1 of log₂ value, patients were divided into two groups: low, with Drosha log₂ value expression <1.1; and high, with Dicer log₂ value expression = 1.1. X‐axis, log₂ value; Y‐axis, number of cases.

Relationships between expression of Dicer and Drosha and various clinicopathologic characteristics. Our next investigation was concerned with whether expression levels of either Dicer or Drosha showed any relationship with the clinicopathologic characteristics of lung cancers, and found that there was a statistically significant association between Dicer expression levels and differentiation grade (Table 1). Cases with low Dicer expression showed significantly greater prevalence of poorly differentiated tumors than those with high Dicer expression (P = 0.01), which was also observed in the multivariate logistic regression analysis with adjustment for all the variables analyzed in the univariate analysis (P = 0.02).

Table 1

Relationship between expression levels of Dicer and Drosha and various clinicopathologic characteristics

Characteristics	No. cases	Dicer			Drosha
Characteristics	No. cases	High	Low	P ^*	High	Low	P ^*
Age (years)
≤62	34	29	5	0.75	22	12	0.03
>62	33	27	6		12	21
Sex
Male	41	34	7	1.00	21	20	1.00
Female	26	22	4		13	13
Histology
Squamous	11	10	1	0.68	5	6	0.75
Non‐squamous	56	46	10		29	27
Smoking history
Smoker	38	31	7	0.75	19	19	1.00
Non‐smoker	29	25	4		15	14
Disease stage
I	37	31	6	1.00	20	17	0.63
II‐III	30	25	5		14	16
Differentiation
Poor	15	9	6	0.01	5	10	0.15
Well or moderate	52	47	5		29	23

Open in a separate window

^* Two‐sided Fisher's exact test.

Association between low Dicer expression and shortened postoperative survival. The next question to be examined was whether expression levels of Dicer and Drosha were associated with patient survival after surgery. The Kaplan‐Meier survival curves demonstrated that the probability of survival was significantly lower for the group of patients with low levels of Dicer expression (P = 0.0001 by log‐rank test; Fig. 2A), while low expression of Drosha tended to be associated with a worse prognosis (P = 0.06 by log‐rank test; Fig. 2B). Prognostic values of various factors were studied by univariate Cox regression analysis (Table 2). It was shown that, in addition to disease stage (P = 0.003), low Dicer expression was a significant predictive factor for poor prognosis (P < 0.001), whereas the Drosha expression level did not show a significant association with survival (P = 0.07).

An external file that holds a picture, illustration, etc.
Object name is CAS-96-111-g002.jpg

Open in a separate window

Figure 2

Analysis of overall survival of patients with high or low expression of double‐stranded RNA‐specific endonucleases. (A) Kaplan‐Meier survival curves for lung cancer patients, who were classified as showing either high or low Dicer expression. Dicer status was found to be strongly associated (log‐rank, P = 0.0001) with patient survival. (B) Kaplan‐Meier survival curve for lung cancer patients, who were classified as showing either high or low Drosha expression. Drosha status did not show a significant (log‐rank, P = 0.06) relationship with patient survival. X‐axis, length of survival after surgery; Y‐axis, percentage of survivors.

Table 2

Univariate and multivariate Cox regression analyses of the relationship between expression levels of Dicer and various clinical characteristics

Univariate analysis
Variables	HR [95% CI]	Unfavorable/Favorable	P
Age (years)	2.02 [0.80–5.14]	>62/≤62	0.14
Sex	2.79 [0.92–8.41]	Male/Female	0.07
Histology	1.37 [0.45–4.14]	Squamous/Non‐squamous	0.58
Smoking history	2.52 [0.91–7.01]	Smoker/Non‐smoker	0.08
Disease stage	4.61 [1.66–12.85]	II‐III/I	0.003
Differentiation	2.55 [1.00–6.49]	Poor/Well or moderate	0.05
Dicer	5.18 [2.07–12.97]	Low/High	<0.001
Drosha	2.45 [0.93–6.45]	Low/High	0.07

Open in a separate window

Multivariate analysis
Variables	HR [95% CI]	Unfavorable/Favorable	P
Age (years)	1.86 [0.64–5.43]	>62/≤62	0.26
Sex	1.08 [0.25–4.64]	Male/Female	0.92
Histology	1.14 [0.29–4.51]	Squamous/Non‐squamous	0.85
Smoking history	2.89 [0.75–11.1]	Smoker/Non‐smoker	0.12
Disease stage	11.3 [2.87–44.3]	II‐III/I	0.001
Differentiation	0.48 [0.12–1.86]	Poor/Well or moderate	0.29
Dicer	17.6 [3.49–89.1]	Low/High	0.001
Drosha	0.91 [0.25–3.36]	Low/High	0.88

Open in a separate window

HR, hazard ratio; CI, confidence interval.

The interrelationship of possible prognostic factors and survival was further analyzed by means of the Cox proportional hazards modeling using age, sex, histology, smoking history, disease stage and differentiation as well as expression levels of Dicer and Drosha as variables. As a result, reduced expression of Dicer, in addition to disease stage (P = 0.001), was identified as a significant and independent prognostic factor (P = 0.001) for surgically treated NSCLC patients after potentially curative resection. The hazard ratio for earlier death was 17.6 [95% confidence interval: 3.49–89.1] for low versus high expression levels of Dicer. These findings provided a strong indication that the expression levels of Dicer appeared to have a significant impact on the postoperative survival of NSCLC patients.

Lack of DNA methylation of the Dicer promoter region. Because DNA methylation of the promoter region is thought to be significantly involved in transcriptional regulation,⁽¹⁸⁾ we used the bisulfite conversion technique to study DNA methylation of the Dicer promoter region in 15 NSCLC (10 with low Dicer expression and five with high Dicer expression), as well as in three normal lung tissues. No methylation of the Dicer promoter region was found in any of the cases regardless of the level of Dicer expression, thus suggesting the involvement of other underlying mechanisms in the reduction of Dicer expression.

Discussion

In the study presented here, we have shown that the reduced expression of Dicer in a significant fraction of lung cancers is associated with shorter postoperative survival. To the best of our knowledge, ours is the first report of alterations of Dicer in human cancers. It should be noted that among the variables used in the multivariate COX regression analysis (i.e. age, sex, histology, smoking history, disease stage and differentiation as well as expression levels of Dicer and Drosha), Dicer appears to have a significant prognostic impact (P = 0.001) independent of disease stage (P = 0.001). Because logistic regression analysis demonstrated that the higher incidence of reduced Dicer expression in poorly differentiated tumors remained significant even after correction for other parameters (P = 0.02), one can speculate that prognostic impact of poor differentiation may well be represented by the presence of reduced expression of Dicer. Although our finding needs to be confirmed, for example on the cutoff value of Dicer expression level, by a further validation study using an independent and larger cohort, reduced expression of Dicer appears to be clinically useful for the prognosis of lung cancer patients. As for the underlying mechanisms involved in reduced Dicer expression in lung cancers, our study suggests that the involvement of hypermethylation of CpG sites in the promoter region is unlikely, so that other possibilities such as altered chromatin conformation and haploinsufficiency need to be pursued.⁽¹⁸⁾ Corresponding to this, the frequent occurrence of loss of heterozygosity (LOH) on the long arm of chromosome 14, where Dicer resides, has been reported in lung cancers,¹⁹^,²⁰ while a number of studies have also indicated that this chromosomal region is often affected in various other human cancers.²¹^,²²^,²³^,²⁴^,²⁵^,²⁶ It is interesting that LOH on 14q appears to be related to tumor progression of colon cancer, with a higher incidence of this anomaly in metastatic sites than in primary tumors.⁽²⁷⁾

Accumulating evidence supports the notion that the prognostic impact of reduced Dicer expression observed in our study might have a functional role in the development of lung cancers rather than being a mere surrogate marker. In correspondence with this, we recently reported that expression levels of let‐7 microRNA were frequently reduced in lung cancers, both in vitro and in vivo, and that lung cancer patients with reduced let‐7 expression had a significantly worse prognosis after potentially curative resection independent of disease stage.⁽⁴⁾ We note that significant associations between reduced expression of Dicer and those of let‐7a‐1 (R = 0.66, P < 0.001) and let‐7f‐1 (R = 0.65, P < 0.001) were observed in this study. Since Dicer is required in the processing and generation of a fully mature form of microRNA,¹¹^,¹²^,¹³^,¹⁴^,¹⁵^,¹⁶ it is not inconceivable that reduced Dicer expression may constitute an alternate post‐transcriptional mechanism, which can also reduce expression levels of let‐7 and probably other microRNA in cancer cells.

In addition, other factors may underlie the potential biological effects of reduced Dicer expression in lung cancer cells. In fact, accumulating evidence suggests that the RNAi machinery may be functionally linked to the regulation of chromosome dynamics and genomic integrity. Furthermore, eukaryotic heterochromatin is characterized by a high density of repeats as well as by modified histones, and influences both gene expression and chromosome segregation. It was also found that deletion of Dicer in the fission yeast Schizosaccharomyces pombe resulted in the aberrant accumulation of complementary transcripts from centromeric heterochromatic repeats, loss of histone H3 lysine‐9 methylation, and impairment of centromere function, resulting in defects in proper chromosome segregation.²⁸^,²⁹^,³⁰^,³¹^,³² The presence of marked aneuploidy is one of the key features of lung cancers,⁽³³⁾ while we previously reported the presence of a persistent increase in the rate of chromosomal losses and gains (i.e. chromosome instability, or CIN),⁽³⁴⁾ as well as of frequent impairment of mitotic checkpoints in lung cancer cell lines.⁽³⁵⁾ Therefore, the results of the present study raise the possibility that reduced Dicer expression in lung cancers may render cancer cells susceptible to chromosomal missegregation, in part because of the dysfunction of centromeres in the absence of a surveillance mechanism, which is the impairment of mitotic checkpoints.

It has also been suggested that the RNAi machinery might be involved in X inactivation and imprinting through sequence‐specific histone modification and consequential DNA methylation and epigenetic silencing.⁽²⁸⁾ Therefore, it is possible that reduced expression of Dicer may affect such transcriptional regulation, resulting from the altered activity of the RNAi machinery. In this connection, it should be noted that we previously found that loss of genomic imprinting is a frequent event in human lung cancers.³⁶^,³⁷ It would therefore be of considerable interest to study the involvement of a reduction in Dicer expression in relation to altered genomic imprinting in lung cancers.

In conclusion, we have been able to demonstrate for the first time that Dicer expression levels are reduced in some lung cancers with a significant prognostic impact on the survival of surgically treated cases. Given the fundamental and multiple biological roles of Dicer in various cellular processes, our results suggest the involvement of reduced Dicer expression in the development of lung cancers, and clearly warrant further investigations of the underlying mechanisms by which this alteration affects patient prognosis for a better understanding of the molecular pathogenesis of this fatal cancer. In addition, future studies to investigate whether altered Dicer expression is present in other types of human cancers should be both interesting and important.

Acknowledgments

The authors would like to thank Dr Keitaro Matuo at Division of Epidemiology and Prevention of Aichi Cancer Center for his helpful suggestions in biostatistical analysis. This work was supported in part by a Grant‐in‐Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science and Technology of Japan, a Grant‐in‐Aid for Scientific Research (B) from the Japan Society for the Promotion of Science and a Grant‐in‐Aid for the Second Term Comprehensive Ten‐Year Strategy for Cancer Control from the Ministry of Health and Welfare, Japan.

References

1. Minna JD. Neoplasms of the lung. In: Fauci A, Braunwald E, Kasper D, Hauser S, Longo D, Jameson J (eds). Harrison's principles of internal medicine, 15th edn. McGraw‐Hill, New York 2001; 562–71. [Google Scholar]

2. Statistics and Information Department, Minister's Secretariat. Vital statistics of Japan 2001, Vol. 3. Ministry of Health, Labor and Welfare, Tokyo 2003. ; 384–411. [Google Scholar]

3. Osada H, Takahashi T. Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer. Oncogene 2002; 21: 7421–34. [PubMed] [Google Scholar]

4. Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, Mitsudomi T, Takahashi T. Reduced expression of the let‐7 microRNA in human lung cancers in association with shortened postoperative survival. Cancer Res 2004; 64: 3753–6. [PubMed] [Google Scholar]

5. Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM. Frequent deletions and down‐regulation of micro‐RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 2002; 99: 15524–9. [PMC free article] [PubMed] [Google Scholar]

6. Michael MZ, Sm OC, Van Holst Pellekaan NG, Young GP, James RJ. Reduced accumulation of specific microRNA in colorectal neoplasia. Mol Cancer Res 2003; 1: 882–91. [PubMed] [Google Scholar]

7. Ambros V. MicroRNA pathways in flies and worms. growth, death, fat, stress, and timing. Cell 2003; 113: 673–6. [PubMed] [Google Scholar]

8. Bartel DP. MicroRNA: genomics, biogenesis mechanism and function. Cell 2004; 116: 281–97. [PubMed] [Google Scholar]

9. Grosshans H, Slack FJ. Micro‐RNA: small is plentiful. J Cell Biol 2002; 156: 17–21. [PMC free article] [PubMed] [Google Scholar]

10. Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S, Kim VN. The nuclear RNase III Drosha initiates microRNA processing. Nature 2003; 425: 415–9. [PubMed] [Google Scholar]

11. Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T, Zamore PD. A cellular function for the RNA‐interference enzyme Dicer in the maturation of the let‐7 small temporal RNA. Science 2001; 293: 834–8. [PubMed] [Google Scholar]

12. Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001; 409: 363–6. [PubMed] [Google Scholar]

13. Grishok A, Pasquinelli AE, Conte D, Li N, Parrish S, Ha I, Baillie DL, Fire A, Ruvkun G, Mello CC. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNA that control C. elegans developmental timing. Cell 2001; 106: 23–34. [PubMed] [Google Scholar]

14. Ketting RF, Fischer SE, Bernstein E, Sijen T, Hannon GJ, Plasterk RH. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans . Genes Dev 2001; 15: 2654–9. [PMC free article] [PubMed] [Google Scholar]

15. Knight SW, Bass BL. A role for the RNase III enzyme DCR‐1 in RNA interference and germ line development in Caenorhabditis elegans . Science 2001; 293: 2269–71. [PMC free article] [PubMed] [Google Scholar]

16. Lee Y, Jeon K, Lee JT, Kim S, Kim VN. MicroRNA maturation: stepwise processing and subcellular localization. Embo J 2002; 21: 4663–70. [PMC free article] [PubMed] [Google Scholar]

17. Osada H, Tatematsu Y, Masuda A, Saito T, Sugiyama M, Yanagisawa K, Takahashi T. Heterogeneous transforming growth factor (TGF)‐β unresponsiveness and loss of TGF‐β receptor type II expression caused by histone deacetylation in lung cancer cell lines. Cancer Res 2001; 61: 8331–9. [PubMed] [Google Scholar]

18. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev 2002; 16: 6–21. [PubMed] [Google Scholar]

19. Abujiang P, Mori TJ, Takahashi T, Tanaka F, Kasyu I, Hitomi S, Hiai H. Loss of heterozygosity (LOH) at 17q and 14q in human lung cancers. Oncogene 1998; 17: 3029–33. [PubMed] [Google Scholar]

20. Wong MP, Lam WK, Wang E, Chiu SW, Lam CL, Chung LP. Primary adenocarcinomas of the lung in nonsmokers show a distinct pattern of allelic imbalance. Cancer Res 2002; 62: 4464–8. [PubMed] [Google Scholar]

21. Suzuki T, Yokota J, Mugishima H, Okabe I, Ookuni M, Sugimura T, Terada M. Frequent loss of heterozygosity on chromosome 14q in neuroblastoma. Cancer Res 1989; 49: 1095–8. [PubMed] [Google Scholar]

22. Cliby W, Ritland S, Hartmann L, Dodson M, Halling KC, Keeney G, Podratz KC, Jenkins RB. Human epithelial ovarian cancer allelotype. Cancer Res 1993; 53: 2393–8. [PubMed] [Google Scholar]

23. Nawroz H, Van Der Riet P, Hruban RH, Koch W, Ruppert JM, Sidransky D. Allelotype of head and neck squamous cell carcinoma. Cancer Res 1994; 54: 1152–5. [PubMed] [Google Scholar]

24. Chang WY, Cairns P, Schoenberg MP, Polascik TJ, Sidransky D. Novel suppressor loci on chromosome 14q in primary bladder cancer. Cancer Res 1995; 55: 3246–9. [PubMed] [Google Scholar]

25. Herbers J, Schullerus D, Muller H, Kenck C, Chudek J, Weimer J, Bugert P, Kovacs G. Significance of chromosome arm 14q loss in nonpapillary renal cell carcinomas. Genes Chromosomes Cancer 1997; 19: 29–35. [PubMed] [Google Scholar]

26. De Rienzo A, Jhanwar SC, Testa JR. Loss of heterozygosity analysis of 13q and 14q in human malignant mesothelioma. Genes Chromosomes Cancer 2000; 28: 337–41. [PubMed] [Google Scholar]

27. Young J, Leggett B, Ward M, Thomas L, Buttenshaw R, Searle J, Chenevix‐Trench G. Frequent loss of heterozygosity on chromosome 14 occurs in advanced colorectal carcinomas. Oncogene 1993; 8: 671–5. [PubMed] [Google Scholar]

28. Volpe TA, Kidner C, Hall IM, Teng G, Grewal SI, Martienssen RA. Regulation of heterochromatic silencing and histone H3 lysine‐9 methylation by RNAi. Science 2002; 297: 1833–7. [PubMed] [Google Scholar]

29. Hall IM, Shankaranarayana GD, Noma K, Ayoub N, Cohen A, Grewal SI. Establishment and maintenance of a heterochromatin domain. Science 2002; 297: 2232–7. [PubMed] [Google Scholar]

30. Provost P, Silverstein RA, Dishart D, Walfridsson J, Djupedal I, Kniola B, Wright A, Samuelsson B, Radmark O, Ekwall K. Dicer is required for chromosome segregation and gene silencing in fission yeast cells. Proc Natl Acad Sci U S A 2002; 99: 16648–53. [PMC free article] [PubMed] [Google Scholar]

31. Hall IM, Noma K, Grewal SI. RNA interference machinery regulates chromosome dynamics during mitosis and meiosis in fission yeast. Proc Natl Acad Sci U S A 2003; 100: 193–8. [PMC free article] [PubMed] [Google Scholar]

32. Volpe T, Schramke V, Hamilton GL, White SA, Teng G, Martienssen RA, Allshire RC. RNA interference is required for normal centromere function in fission yeast. Chromosome Res 2003; 11: 137–46. [PubMed] [Google Scholar]

33. Masuda A, Takahashi T. Chromosome instability in human lung cancers: possible underlying mechanisms and potential consequences in the pathogenesis. Oncogene 2002; 21: 6884–97. [PubMed] [Google Scholar]

34. Haruki N, Harano T, Masuda A, Kiyono T, Takahashi T, Tatematsu Y, Shimizu S, Mitsudomi T, Konishi H, Osada H, Fujii Y, Takahashi T. Persistent increase in chromosome instability in lung cancer: possible indirect involvement of p53 inactivation. Am J Pathol 2001; 159: 1345–52. [PMC free article] [PubMed] [Google Scholar]

35. Takahashi T, Haruki N, Nomoto S, Masuda A, Saji S, Osada H, Takahashi T. Identification of frequent impairment of the mitotic checkpoint and molecular analysis of the mitotic checkpoint genes, hsMAD2 and p55CDC, in human lung cancers. Oncogene 1999; 18: 4295–300. [PubMed] [Google Scholar]

36. Suzuki H, Ueda R, Takahashi T. Altered imprinting in lung cancer. Nat Genet 1994; 6: 332–3. [PubMed] [Google Scholar]

37. Kondo M, Suzuki H, Ueda R, Osada H, Takagi K, Takahashi T, Takahashi T. Frequent loss of imprinting of the H19 gene is often associated with its overexpression in human lung cancers. Oncogene 1995; 10: 1193–8. [PubMed] [Google Scholar]

Articles from Cancer Science are provided here courtesy of Wiley