Loss of ATRX leads to chromosome cohesion and congression defects

Prolonged prometaphase-to-metaphase transition upon down-regulation of ATRX

To investigate the kinetics of mitotic progression, we assessed the outcome of both transient and stable depletion of ATRX in HeLa cells that express histone H2B fused to GFP (HeLa-H2B-GFP [HG]). Stable clones were difficult to expand, which suggests that reduced ATRX expression imparts negative effects on cell division, proliferation, or viability. A negative impact on cell division was previously reported upon conditional ablation of the full-length ATRX protein in embryonic stem cells, although the cause was not determined (Garrick et al., 2006). We chose two stable cell lines for our analysis, designated shATRX1 and shATRX2, each expressing a short hairpin RNA that targets a distinct sequence within the ATRX transcript. Both stable clones expressed substantially reduced levels of ATRX RNA and protein as determined by Q-RT-PCR and Western blot analysis (Fig. 2 A).

Open in a separate window

Figure 2.

Stable and transient depletion of ATRX extends the transition to metaphase and induces congression defects. (A) HeLa-HG cells that stably express pSuper-shATRX1, pSuper-shATRX2, or pSuper (empty vector control) were generated and the level of ATRX depletion was measured by Q-RT-PCR (top) and Western blot analysis (bottom). Q-RT-PCR results were normalized to GAPDH expression and protein loading on the Western blot was controlled with α-tubulin. Error bars represent the standard deviation from triplicate samples. (B) Mitotic cells were followed in real time by videomicroscopy and the duration of prometaphase was measured for HG control and HG-shATRX1 stably depleted cells (n = 50 each) and also in transient transfections with siATRX1 (n > 120). Horizontal lines indicate the mean value of each dataset. (C) The fraction of metaphasic cells with misaligned chromosomes (inset) was evaluated in live cell cultures of HeLa-HG, HG-pSuper, HG-shATRX1, and HG-shATRX2 stable clones (n = 100 for each). (D) Live mitotic cells were followed over a 10 h period and scored for congression defects in stable (n = 50) and transient experiments (n > 120). (E) Selected panels from live cell videomicroscopy experiments of control HeLa-HG cells and ATRX-depleted cells from nuclear envelope breakdown (NEBD) to anaphase onset (AO). ATRX-depleted mitotic cells often displayed misaligned chromosomes (arrowheads) that resolved before the onset of anaphase (middle), whereas, in some cases, anaphase was initiated despite the presence of misaligned chromosomes (bottom). A subset of metaphase chromosomes underwent cycles of general decondensation and recondensation (the asterisk indicates a decondensed metaphase plate). Numbers indicate minutes after NEBD. (F) Morphological assessment of chromosome decondensation in control and transiently depleted cells. Graph depicts the percentage of metaphase spreads that display a more decondensed appearance (far right). Bars: (C) 5 μm; (E) 16 μm, (F) 20 μm.

Time-lapse videomicroscopy was used to evaluate the outcome of both transient and stable ATRX silencing. We generated videos of live cells (10 h) and from these measured the time required to complete each stage of mitosis (stable clone, n = 50; transient depletion, n ≥ 120). This analysis revealed that ATRX-depleted cells took longer than control cells to undergo mitosis (Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200706083/DC1) because of an extended transition from prometaphase to fully aligned metaphase (Fig. 2 B; P < 0.001). The delays in prometaphase were underestimated because a subset of mitotic cells that were arrested at prometaphase or metaphase for the total duration of the observation period (10 h) were not included in this analysis. These chronically arrested prometaphase cells often became nonadherent and/or died, as indicated by membrane blebbing and highly condensed chromatin (Video 1). Collectively, these results show that ATRX is required for the normal transition from prometaphase to metaphase during mitosis.

ATRX depletion affects chromosome congression

The mitotic delay in ATRX-depleted cells occurred primarily between prometaphase and metaphase, a time when condensed chromosomes are congressing toward the metaphase plate. We noticed that metaphase plates in transiently depleted cells and in the shATRX1 and shATRX2 stable cell lines were often characterized by misaligned chromosomes or chromosomes that remained randomly distributed over the bipolar microtubule spindle (Fig. 2 C and Video 2, available at http://www.jcb.org/cgi/content/full/jcb.200706083/DC1), which suggests that the prometaphase-to-metaphase delay might be caused by impaired chromosome congression to the spindle equator. To evaluate the extent of this defect, we scored the number of metaphasic cells with misaligned chromosomes in control and ATRX-depleted live cell cultures. A greater proportion of metaphase plates had misaligned chromosomes in the shATRX1- and shATRX2-depleted clones compared with controls (Fig. 2, C and E). In addition, we followed stably (shATRX1, n = 100) and transiently (siATRX, n ≥ 120) depleted mitotic cells by videomicroscopy over a 10-h period and observed an approximately threefold (stable depletion) and fourfold (transient depletion) increase in the number of cells displaying congression defects in ATRX-depleted cells compared with control cells during that time period (Fig. 2 D). In addition, metaphasic cells often appeared less condensed in ATRX-depleted cells and were sometimes observed to undergo decondensation/recondensation before anaphase onset by live imaging (Fig. 2 E, middle; and Video 3). We further confirmed the general decondensed appearance of ATRX-depleted metaphasic chromosomes by staining chromosome spreads with DAPI. The frequency of spreads with a staining pattern indicative of more decondensed chromatin (wider chromosomes) was higher in cells transiently depleted of ATRX using siATRX1 and siATRX2 duplexes (Fig. 2 F) than in control cells. These results demonstrate that transient as well as stable silencing of ATRX interferes with normal prometaphase-to-metaphase progression, causes impaired chromosome congression, and is sometimes accompanied by chromosome decondensation.

Sister chromatid cohesion is compromised in ATRX-depleted cells

Abnormal chromosomal congression could be caused by perturbed targeting of outer kinetochore proteins to the centromere, spindle defects, abnormal PCH, or reduced cohesion between sister chromatids. Congression defects have been reported upon depletion of the outer kinetochore proteins centromere-associated protein (CENP)-E and CENP-F (mitosin) that are essential for stable microtubule–kinetochore capture (Wood et al., 1997; Yao et al., 1997; McEwen et al., 2001; Tanudji et al., 2004; Yang et al., 2005). We examined the ability of CENP-E and CENP-F to localize to kinetochores in ATRX-depleted cells and found that both proteins localized normally at the kinetochore of metaphasic cells (Fig. 3 A). The loss of factors that control PCH structure can also cause aberrant mitosis (Melcher et al., 2000; Peters et al., 2001). Specific histone modifications that characterize PCH, including trimethylated H3K9 and H4K20 and monomethylated H3K27, were not visibly affected in ATRX-depleted cells (unpublished data). Trimethylation of Lys9 on histone H3 (H3K9me3) by the Suv39H1 methyltransferase recruits HP1α and forms a compact heterochromatic structure. HP1α in turn interacts with several chromatin factors, including NIPBL, ATRX, and chromatin assembly factor 1 (Lechner et al., 2005). However, we observed that nuclear HP1α as well as HP1β immunoreactivity were indistinguishable between transiently depleted and control cells (Fig. S3, available at http://www.jcb.org/cgi/content/full/jcb.200706083/DC1), which suggests that ATRX is not required for proper targeting of these proteins to PCH.

Open in a separate window

Figure 3.

Increased interkinetochore distances and reduced cohesion in ATRX-depleted cells. (A) ATRX-depleted metaphase cells were stained for the kinetochore proteins CENP-F or CENP-E (green) in combination with CREST (red) and imaged at different z planes. Images represent an extended focus rendering of deconvoluted z stacks. (B) Control and ATRX-depleted cells were stained with anti-CREST antibody to stain kinetochores. Distances between paired kinetochores (n = 100) were measured at individual z planes and were significantly increased in shATRX1 and shATRX2 cells compared with controls (P < 0.05 by ANOVA). (C) Mitotic HeLa cells were transiently transfected with either siATRX-Scr control or siATRX1 and siATRX2 duplexes. After mitotic shake-off to remove any cells in mitosis, cells were treated with colcemid and chromosome spreads were stained with DAPI and scored for the percentage of chromatids displaying cohesion defects (n = 50 per treatment). Chromosomes from ATRX-depleted cells showed reduced cohesion compared with control-treated cells. (D) Microscopic images of representative chromosome spreads scored as normal (<10% cohesion defect), moderate (10–90% cohesion defect), or severe (>90% cohesion defect). Insets show representative chromosomes from each spread with normal (left), moderate (middle), and severe (right) cohesion defects. Bars: (A and B) 5 μm; (C) 20 μm.

We next measured the distance between metaphasic sister kinetochores in ATRX-depleted cells using CREST immunostaining. Sister chromatid interkinetochore distances were significantly increased in both shATRX1- and shATRX2-aligned metaphases compared with control metaphases (Fig. 3 B, P < 0.05 by analysis of variance [ANOVA]). Increased distance between sister chromatids could reflect a more decondensed state of chromatin and perhaps fewer nucleosomes associated with centric chromatin. Alternatively, increased interkinetochore distances could be explained by reduced cohesion between sister chromatids. We evaluated the extent of cohesion between the chromatid pairs in DAPI-stained metaphase chromosome spreads after transient depletion using siATRX1 and siATRX2 duplexes in HeLa cells. To rule out possible effects of extended mitotic arrest (Fig. 2 B), we performed a mitotic shake-off to remove mitotic cells before colcemid treatment. As a control for nonspecific siRNA effects, cells were transfected with an siATRX1 scrambled duplex. Mitotic chromosomes from control metaphase spreads exhibited an association of the chromosome arms with a primary constriction at the centromeres, resulting in the typical “X-shaped” chromosomal morphology (Fig. 3 D, left). In contrast, after transient ATRX interference, we observed a higher proportion of chromosomes that were separated along the chromosome length with no evidence of primary centromeric constrictions, which indicates reduced centromeric cohesion (Fig. 3 C). To evaluate the extent of this defect, chromosome spreads (n = 100 per treatment) were categorized as having a normal (<10%), moderate (10–90%), or severe (>90%) loss of chromatid cohesion (Fig. 3 D). We found that ATRX-depleted cells had a higher occurrence of spreads displaying cohesion defects compared with the mock-transfected and nonspecific siRNA controls (Fig. 3 C). Severe loss of cohesion (>90% of chromosome pairs displaying loss of cohesion) was observed at low levels in both controls and depleted cells (Fig. 3, C and D), indicating that ATRX depletion results in reduced but not complete loss of sister chromatid cohesion.

ATRX depletion transiently activates the spindle checkpoint

The mitotic delay incurred by ATRX depletion prompted us to survey the status of the spindle checkpoint proteins in ATRX-depleted cells. As such, the preanaphase mitotic delay might result from continued mitotic checkpoint signaling at misaligned chromosomes. Activation of the spindle checkpoint was confirmed by staining for the checkpoint proteins BubR1 and Bub1 at misaligned chromosomes. We observed that both proteins were enriched at a subset of kinetochores in ATRX-depleted metaphases, with a strong signal at misaligned chromosomes (Fig. 4 A). We further tested the robustness of the spindle checkpoint by analyzing the fate of cells after exposure to nocodazole, a microtubule-depolymerizing agent. Nocodazole-induced mitotic arrest was robust in both control and ATRX-depleted cells, demonstrating that ATRX is not required for spindle checkpoint activation (Fig. 4 B). We next selectively destabilized nonkinetochore fibers by cold treatment. The residual intact kinetochore fibers were visualized by α-tubulin staining. We observed that ATRX depleted cells were characterized by highly irregular arrays of kinetochore fibers (Fig. S4, available at http://www.jcb.org/cgi/content/full/jcb.200706083/DC1).

Open in a separate window

Figure 4.

Spindle checkpoint activation and aberrant chromosome segregation in ATRX-depleted cells. (A) The spindle checkpoint protein BubR1 was detected in ATRX-depleted metaphase cells at both aligned and misaligned chromosomes (top). Another checkpoint protein, Bub1, was also found to be adjacent to the centromeres (CREST staining) in ATRX-depleted metaphase cells. (B) Mitotic index of control and ATRX-depleted cells after 16 h of nocodazole treatment. Control and ATRX-depleted cells were cultured with or without nocodazole for 16 h and live cells were photographed and scored for the percentage of mitotic rounded cells by phase imaging (n > 1,000). (C) Live cell imaging of control and ATRX-depleted mitotic cells (n = 100 for each cell line) revealed an increased number of cells that undergo repeated failed attempts at initiating anaphase, an increased number of cells that initiate anaphase without full chromosome alignment, and an increased incidence of segregation defects as indicated by the formation of chromosome DNA bridges and micronuclei. (D) The number of internuclear bridges and micronuclei indicative of chromosome missegregation were quantified at 2–4 d after transfection of the siATRX1 duplex and the fold difference between mock and depleted cells was calculated. (E) Fixed mitotic cells stained with DAPI (blue) and a phosphohistone H3S10 antibody (red) showing intranuclear DNA bridges and micronuclei in transiently depleted cells. Bars, 5 μm.

Reduced levels of ATRX induce chromosome segregation defects

Despite the activation of spindle checkpoint proteins, we observed a modest accumulation of mitotic cells in ATRX-depleted cultures by FACS analysis (Fig. S2 B), which suggests that checkpoint activation could not be maintained completely in all cells. As a result, an increased number of cells with lagging chromosomes at anaphase, telophase, and G1 (Fig. 4 D and Video 4, available at http://www.jcb.org/cgi/content/full/jcb.200706083/DC1) were observed, indicating a problem with chromosome segregation. A three- to sevenfold increase in the number of cells displaying interphase DNA bridges was observed 48–96 h after transfection with ATRX siRNA duplexes compared with control cells (Fig. 4, D and E). DNA bridges in mammalian cells produce micronuclei when the bridges resolve and reform as small membrane-bound DNA bodies (Hoffelder et al., 2004). The number of micronuclei increased 3.4-fold compared with control cells by 96 h after siRNA treatment (Fig. 4 D). Collectively, these data suggest that the spindle checkpoint control is compromised in a subset of cells, causing chromosome segregation errors characterized by lagging chromosomes, interphase DNA bridges, and the subsequent formation of micronuclei.

RNA interference

The synthetic oligonucleotides siATRX1 (5′-GAGGAAACCUUCAAUUGUAUU-3′), siATRX2 (5′-GCAGAGAAAUUCCUAAAGAUU-3′), and siATRX1 scrambled (5′-GAUUGAAGACUGAUAUCACUU-3′) were obtained from Dharmacon. The control (nontargeting) duplex was obtained from Sigma-Aldrich. siRNA duplexes were transfected with Lipofectamine 2000 according to the manufacturer's instructions. Mock-transfected samples were treated similarly but without the addition of siRNA.

Western blot analysis

Cells were lysed with RIPA buffer (150 mM NaCl, 1% NP-40, 50 mM Tris, pH 8.0, 0.5% deoxycholic acid, 0.1% SDS, 0.2 mM PMSF, 0.5 mM NaF, 0.1 mM Na₃VO₄, and 1 protease inhibitor cocktail tablet [Complete mini, EDTA-free; Roche]) for 5 min on ice. Extracts were sonicated and quantified using the DC protein assay (Bio-Rad Laboratories). 20 μg of protein was resolved on 6 or 12% SDS-PAGE and transferred onto nitrocellulose membranes (Bio-Rad Laboratories). The membranes were probed with rabbit α-ATRX H300 (Santa Cruz Biotechnology, Inc.), mouse α-ATRX 39f (a gift of D.J. Picketts, Ottawa Health Research Institute, Ottawa, Canada; and D. Higgs, University of Oxford, Oxford, UK), followed by the appropriate horseradish peroxidase–conjugated secondary antibody (1:5,000; GE Healthcare). After washing, the membrane was incubated in ECL before exposure to x-ray film. The membrane was reprobed with mouse α–α-tubulin (1:40,000; Sigma-Aldrich) as a loading control.

Q-RT-PCR analysis

Total RNA was isolated using the RNeasy mini kit (QIAGEN). First-strand cDNA was synthesized from 3 μg of total RNA using random primers and a reverse transcription cocktail containing 5× first strand buffer, 100 mM DTT, 25 mM dNTPs, RNA guard (GE Healthcare), and Superscript RT (Invitrogen). PCR reactions were performed on a continuous fluorescence detector (Chromo4; MJ Research) in the presence of iQ SYBR green supermix (Bio-Rad Laboratories) and analyzed with Opticon Monitor 3 and GeneX software (Bio-Rad Laboratories) using the standard curve corresponding threshold method of quantification. Samples were amplified as follows: 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. After 30 cycles, a melting curve was generated to visualize amplicon purity. Standard curves were generated for each primer pair using fivefold serial dilutions of control cDNA. Primer efficiency was calculated as %E = [(10^(−1/slope) – 1] × 100%, where a desirable slope is −3.32 and r² > 0.99. All data were normalized GAPDH expression levels. The primers used for Q-RT-PCR were as follows: ATRX-F, 5′-TCCTTGCACACTCATCAGAAGAATC-3′; ATRX-R, 5′-CGTGACGATCCTGAAGACTTGG-3′; GAPDH-F, 5′-GAGTCAACGGATTTGGTCGT-3′; and GAPDH-R, 5′-GACAAGCTTCCCGTTCTCAG-3′.

Flow cytometry

Exponentially growing cells were harvested, washed with calcium/magnesium-free (CMF) PBS (137 mM NaCl, 2.7 mM KCl, 1.5 mM potassium phosphate monobasic, and 12 mM sodium phosphate dibasic) three times and 1.5 × 10⁶ cells were fixed dropwise with 90% ethanol and stored at 4°C for at least 12 h. To detect DNA content, cells were washed and stained with propidium iodide/RNase staining solution (10 μg/ml propidium iodide), 250 μg/ml RNase A (Sigma-Aldrich), and 2% BSA in CMF PBS for 30 min at room temperature followed by overnight incubation at 4°C. Cell populations were analyzed by flow cytometry on an EPICS XL-MCL instrument (Beckman-Coulter). Data analysis to determine the proportion of cells in each phase of the cell cycle was performed using the Expo 32 software package (Beckman Coulter).

Indirect immunofluorescence microscopy

For immunofluorescence detection, cells were fixed with 3:1 ethanol/methanol up to 4 d after control or siRNA transfection and incubated with the following primary antibodies: α-ATRX H300 (1:200; Santa Cruz Biotechnology, Inc.), α-ATRX 39f (1:20; provided by D.J. Picketts), α–α-tubulin (1:1,500; Sigma-Aldrich), α-phosphohistone H3(S10) (1:200; Millipore), human α-CREST (1:10,000; W. Brinkley, Baylor College of Medicine, Houston, TX), α-BubR1 (1:200; BD Biosciences), α-Bub1 (1:1,000; a gift from S. Taylor, University of Manchester, Manchester, UK), α-CENP-E (1:400; Santa Cruz Biotechnology, Inc.), α–CENP-F (a gift from S. Taylor), α-HP1α (1:200; Millipore), and α-HP1β (1:200; Millipore). Secondary antibodies included goat α–rabbit Alexa 594 (1:1,500), donkey α–rabbit Alexa 488 (1:1,500), goat α–mouse Alexa 488 (1:1,500), goat α–mouse Alexa 594 (1:1,500), and goat α–human Alexa 647 (1:1,500; Invitrogen). Coverslips were mounted with Vectashield H-1000 (Vector Laboratories).

Generation of ATRX-depleted stable clones

Pairs of sense 60-mer oligonucleotides corresponding to the 19-mer siATRX1 and siATRX2 siRNA target sequences and their reverse complement (underlined sequences) were designed that contained 5′ BglII and 3′ HindIII restriction sites to facilitate cloning (Integrated DNA Technologies, Inc.). Sequences were as follows: shATRX1 (sense), 5′-GATCCCCGAGGAAACCTTCAATTGTATTCAAGAGATACAATTGAAGGTTTCCTCTTTTTA-3′, and shATRX2 (sense), 5′GATCCCCGCAGAGAAATTCCTAAAGATTCAAGAGATCTTTAGGAATTTCTCTGCTTTTTA-3′. The oligonucleotides were annealed to complimentary antisense 60-mer oligonucleotides in buffer containing 10 mM Tris, pH 7.5, 50 mM NaCl, and 1 mM EDTA at 90°C for 4 min followed by 70°C for 10 min, and then step cooled to 37°C for 20 min using a thermocycler (MJ Research) and cloned into the pSuper.retro.neo plasmid (Oligoengine) using the Quick ligation kit according to manufacturer's instructions (New England Biolabs, Inc.). The resulting vectors, designated pSUPER-shATRX1 and pSUPER-shATRX2, were subsequently sequenced to confirm sequence identity. Exponentially growing HG were transfected with empty pSuper vector or with pSuper-shATRX1 and pSuper-shATRX2 vectors (1 μg/ml) using Lipofectamine 2000. 2 d after transfection, cells were replated at low density and selection was applied 24 h later (800 μg/ml geneticin; Invitrogen). Drug-resistant colonies were picked and expanded in selection media (400 μg/ml geneticin).

Time-lapse and live cell microscopy

HeLa-HG, HG-pSuper, HG-shATRX1, or HG-shATRX2 cells were plated on 35-mm glass-bottom tissue culture dishes (MatTek) in DME with 10% FBS. After 24 h, the media was replaced with CO₂-independent media (Invitrogen) supplemented with 10% FBS and 4 mM l-glutamine (Sigma-Aldrich). For transient experiments, cells were plated and transfected and scored 48–72 h after transfection. Cells were imaged using an automated inverted microscope (DMI 6000b; Leica) equipped with a live cell stage-mounted environment chamber (Neue Biosciences) to maintain the cells at 37°C during imaging. Phase-contrast and fluorescence (GFP) images were captured every 3 min for 10 h using Openlab Software automation (5.0; PerkinElmer). To measure mitotic duration, cells that initiated mitosis (determined by nuclear envelope breakdown) and reentered G1 (nuclear decondensation) within the time frame of the experiment (10 h) were analyzed (n > 50). This analysis did not include cells that were arrested at prometaphase or that died during the timeframe of the experiment. To measure the frequency of unaligned chromosomes at metaphase, cells were seeded in 35-mm culture wells (BD Biosciences) in DME with 10% FBS and at least 500 metaphase cells were scored per sample. For mitotic spindle checkpoint arrest, HeLa-HG or HG-shATRX1 cells were treated with 100 ng/ml nocodazole for 16 h. Rounded mitotic cells and adherent interphase cells were quantified using live cell microscopy (n > 1,000).

Fixed chromosome spreads

HeLa cells were transiently transfected with no siRNA duplex (mock), siATRX1 scrambled (nonspecific control), siATRX1, or siATRX2. 70 h after transfection, mitotically arrested cells were removed by shake-off and adherent cells were treated with 100 ng/ml KaryoMAX Colcemid (Invitrogen) for 2 h. Mitotic cells were then isolated and incubated in hypotonic solution (75 mM KCl) for 20 min followed by fixation in Carnoy's Fix (3:1 methanol/acetic acid) and stored at −20°C. Fixed cells were dropped onto Superfrost Plus glass microscope slides (Thermo Fisher Scientific) and air dried; DNA was counterstained with 100 ng/ml DAPI and mounted in Vectashield H-1000. For z-stack imaging, 0.4-μm-interval z stacks were captured and deconvolved using iterative restoration with Volocity imaging software (4.0; PerkinElmer).

Measure of interkinetochore distances

To measure interkinetochore distance, mitotic HeLa-HG, HG-pSuper, HG-shATRX1, and HG-shATRX2 stable cells were fixed in 3:1 ethanol/methanol and the kinetochores were stained using the human CREST antibody (1:10,000) and imaged using a 63× 1.4 NA oil immersion objective (Leica). Z stacks were captured at 0.4-μm z intervals spanning 20 μm. Kinetochore pairs were connected from the outer edges of the CREST signal and the distance was measured using Volocity software. Only kinetochore pairs in single optical sections that were aligned at the metaphase plate were used to measure interkinetochore distances (n ≥ 100). Statistical differences were assessed by ANOVA. Significant differences in mean interkinetochore distance were assessed by ANOVA and a Tukey's multiple comparison post hoc test. Differences were considered significant when P < 0.05. Statistical analysis was performed using GraphPad Prism (4.02; GraphPad Software, Inc.).

Kinetochore microtubule assay

HeLa-HG, HG-pSuper, HG-shATRX1, or HG-shATRX2 cells were seeded in 35-mm dishes (Corning) in 2 ml DME with 10% FBS on 22-mm² glass coverslips (VWR). After 48 h, the growth medium was replaced with ice-cold growth medium and the cells were incubated on ice for 10 min. The cells were rinsed twice with ice-cold PHEM buffer (60 mM piperazine ethanesulfonic acid, 45 mM Hepes, 10 mM EGTA, and 2 mM MgCl₂, pH 6.9), permeabilized with cold 0.5% Triton X-100 in PHEM buffer for 3 min, and fixed in cold 3.5% paraformaldehyde in PHEM for 15 min. The coverslips were rinsed with PHEM and processed for immunofluorescence staining and microscopy.

Analysis of mitotic cells in the developing telencephalon

The generation of Atrx ^loxP mice was described previously (obtained from D. Higgs and R. Gibbons, University of Oxford; Berube et al., 2005; Garrick et al., 2006). Male embryos conditionally deficient for Atrx were obtained by crossing homozygous Atrx ^loxP females to heterozygous Foxg1Cre knock-in male mice and embryonic yolk sac DNA from E13.5 embryos was genotyped by PCR as described previously (Berube et al., 2005). Midday of the day of vaginal plug discovery was considered to be E0.5. At scheduled times, pregnant females were anesthetized with CO₂ and killed by cervical dislocation. Embryos and postnatal brains were fixed in 4% paraformaldehyde/PBS overnight at 4°C, sunk in 30% sucrose in PBS, and embedded in 15% sucrose and 50% optimal cutting temperature compound (Sakura). Tissue sections were cut at 10-μm thickness and mounted on SuperFrost Plus slides, air dried at room temperature, and stored at −80°C. For immunofluorescence staining, sections were thawed, rehydrated in PBS for 10 min, counterstained with DAPI, and mounted in Vectashield. Micronuclei and misaligned chromosomes from the mitotic layer lining the lateral ventricle were scored from both hemispheres of brain sections (n = 3) in four litter-matched control and ATRX null embryos using fluorescence microscopy. Analysis was restricted to the mitotic layer that lines the hippocampal hem, hippocampal primordium, and the dorsal cortical neuroepithelium (indicated by the area between 1 and 2 in Fig. 5 C).

Details of image acquisition and processing

All samples processed for microscopy were imaged using a DMI 6000b automated inverted microscope. IF images were captured using a 63× 1.4 NA oil immersion lens, a 40× 1.25 NA oil immersion lens (Leica), or a 5× dry objective (Leica). For oil immersion microscopy, we used immersion oil with a refractive index of 1.518 (Leica). All images were captured at ambient temperature except for image capture of live cells and time-lapse experiments, which were performed at 37°C. Experiments used different combinations of DAPI, goat anti–rabbit Alexa 594, goat anti–mouse Alexa 594, donkey anti–rabbit Alexa 488, goat anti–mouse Alexa 488, and goat anti–human 594 secondary antibodies. Digital microscopy images were captured with a digital camera (ORCA-ER; Hammamatsu). Openlab imaging software was used for manual and automated image capture and processing was performed using Volocity. All deconvolution was performed using iterative restoration set with a confidence limit of 95%.

We are grateful to Jamie Seabrook for help with statistical analysis, and Douglas Higgs and Richard Gibbons for the Atrx ^loxP mice.

This work was supported by the Canadian Institutes for Health Research (CIHR; grant MOP-74748) and the Hospital for Sick Children Foundation (grant XG-05-012R) operating grants to N.G. Bérubé. N.G. Bérubé is a CIHR New Investigator.