Existence of the Canonical Wnt Signaling Pathway in the Human Trabecular Meshwork

Immunofluorescence

To study β-catenin translocation, confluent GTM-3 cells cultured on coverslips in 24-well plates were treated with or without 100 ng/mL WNT3a (R&D Systems, Minneapolis, MN) for 4 hours. After washing in PBS, the cells were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) in PBS at 4°C for 30 minutes, washed with PBS, incubated with 0.5% Triton X-100 (Fisher Scientific, Pittsburgh, PA) at room temperature (RT) for 30 minutes, blocked with Superblock (Thermoscientific), and probed with a rabbit anti-β-catenin primary antibody (1:100; Cell Signaling, Beverly, MA) at 4°C overnight. After several PBS washes, cells were probed with a goat anti-rabbit-Alexa-488 secondary antibody (1:200; Invitrogen) at RT for 2 hours. Coverslips were transferred to glass slides and mounted with Prolong Gold mounting medium with or without DAPI (1:100; Invitrogen) for visualization of cell nuclei.

To study actin stress fibers, primary HTM cells were cultured on coverslips placed in 24-well plates. When primary HTM cells had been confluent for 1 week, they were treated with or without 100 or 500 ng/mL WNT3a, 2 or 10 μg/mL sFRP1 (R&D Systems), 10 μM Y27632²¹ (Alcon), or 20 μM LPA²¹ (Sigma-Aldrich, St. Louis, MO) for 1 or 24 hours. At the end of each treatment, cells were processed as described earlier except that they were stained with phalloidin-Alexa-488 or phalloidin-Alexa-568 (Invitrogen) at RT for 30 minutes.

Fluorescent images were taken using a Nikon Ti microscope (Nikon, Melville, NY) with the Nuance Imaging System (CRI, Hopkinton, MA).

Western Immunoblotting (WB)

Confluent GTM-3 cells or primary HTM cells cultured for an additional 7 days after they were confluent were treated with or without 100 ng/mL WNT3a and/or 2 μg/mL sFRP1 for 4 hours. Nuclear proteins and cytosolic proteins were extracted with the NE-PER kit (Thermoscientific). After protein concentrations were determined with the DC protein assay kit (Bio-Rad, Hercules, CA), equal amounts of proteins were boiled in Laemmli buffer, separated on 10% SDS-PAGE gels, transferred to PVDF membranes, blocked with 5% dry milk in tris-buffered saline/Tween (TBST), and probed with primary antibodies and corresponding secondary antibodies conjugated with horseradish peroxidase (HRP). The primary antibodies used in our study included mouse anti-β-catenin (1:500; R&D Systems), rabbit anti-laminA/C (1:1000; Cell Signaling), and rabbit antiglyceraldehyde-3-phosphate dehydrogenase (GAPDH, 1:2000; Cell Signaling). The secondary antibodies included goat anti-mouse-HRP and goat anti-rabbit-HRP (1:10,000; Santa Cruz Biotechnology, Santa Cruz, CA). Signals were developed with the SuperSignal West Femto Substrate (Thermoscientific) and detected using the FluoroChem digital imaging system (Cell Biosciences, Santa Clara, CA). All experiments were performed in biologic replicates (cells from the same strain were used to repeat the experiments at least three times). Representative data are shown.

For the study of MLC phosphorylation, primary GTM cells were treated with WNT3a (100 or 500 ng/mL), sFRP1 (2 or 10 μg/mL), Y27632 (10 μM), or LPA (20 μM) for 1 hour. After a PBS wash, cells were lysed in 2D-buffer containing 7 M urea, 3.5 M thio-urea, CHAPs, and Tris. Protein concentration was measured with the EZQ kit (Invitrogen). For each batch of samples, 5 to 10 μg total protein were separated on two 18% SDS-PAGE gels. After protein transfer, the blots were probed with anti-double phospho-MLC (1:1000) or anti-total MLC (1:500; Cell Signaling), and then probed with goat-anti-rabbit-HRP secondary antibody (1:10,000; Cell Signaling). Images were developed as described above. Each blot was stripped with stripping buffer, and re-probed with anti-GAPDH antibody and secondary antibody for imaging.

Densitometry

The optical density (OD) of each protein band was measured by using the Image J software developed by the National Institutes of Health.

For β-catenin nuclear translocation study, the OD of β-catenin was normalized to laminA/C (for nuclear β-catenin) or GAPDH (for cytosolic β-catenin), that is β-catenin OD/laminA/C OD or β-catenin OD/GAPDH OD, respectively. The OD ratios of nuclear control and cytosolic control then were set at 1.0. The other ratios were normalized to their corresponding control.

Luciferase Assay

For GTM-3 cells, we used plasmid-based TCF/LEF luciferase reporter vectors (Cignal Report; Qiagen, Frederick, MD) according to the manufacturer's instructions. 2 × 10⁴ GTM-3 cells were transfected with 100 ng TCF/LEF reporter plasmid and 0.6 μL SureFECT (Qiagen) in Opti-MEM (Invitrogen), and seeded into individual wells of 96-well opaque plates (BD Falcon, Franklin Lakes, NJ). At 16 hours after transfection, cells were incubated in assay medium (Opti-MEM with 0.5% FBS) for 8 hours. After incubation, cells were treated with or without indicated concentrations of WNT3a and/or sFRP1 for 16 hours. The Dual-Luciferase Reporter Assay System (Promega, Madison, WI) was used to develop luciferase signals, which were measured using a SpectraMax M5 plate reader (Molecular Devices, Sunnyvale, CA). Firefly luciferase levels were normalized to renilla luciferase. Experiments were performed in triplicate (n = 3).

For primary TM cells, we used lentivirus-based TCF/LEF luciferase reporter vectors (Cignal Lenti; Qiagen). We seeded 3000 TM cells into individual wells of 96-well opaque plates. The next day, cells were transduced with the lentivirus at a multiplicity of infection of 100:1 in a total volume of 50 μL medium containing 5 μg/mL SureEntry (Qiagen). After incubation for 24 hours, medium was changed. After another 24 hours of incubation, cells were treated with or without 100 ng/mL WNT3a and/or 2 μg/mL sFRP1 for 18 hours. The Bright-Glow Luciferase Substrate (Promega) was used to develop luciferase signals, which were measured using a M200 plate reader (Tecan, Durham, NC). Experiments were performed in pentaplicates.

Quantitative PCR (qPCR)

HTM cells cultured in 12-well plates were treated with or without 100 ng/mL WNT3a for 4 hours. Total RNA was isolated using the RNeasy Micro Kit (Qiagen). cDNA was synthesized with 0.5 or 1 μg total RNA using the High Capacity cDNA Reverse Transcription Kit (AB Applied Biosystems, Carlsbad, CA). qPCR was performed using one of two protocols. (1) The reaction mixture (25 μL) contained 2.5 μL of 10× PCR buffer (Sigma), 1.25 μL of 25 mM MgCl₂, 0.4 μL JumpStart Taq (Sigma), 0.5 μL of 10 mM dNTPs (Promega), 1.25 μL dimethyl sulfoxide (DMSO), 5 μL of 5M betaine (Fisher Scientific), 0.1 μL of 0.1 mM forward/reverse primer, 1.25 μL of 20× EvaGreen (Biotium, Hayward, CA), and 0.37 μL of the reference dye Rox in a MX3000P thermocycler (Agilent Technologies, Santa Clara, CA). The thermoprofile was 95°C for 15 seconds, 55°C for 30 seconds and 72°C for 30 seconds, consisting of 40 cycles followed by a dissociation curve. (2) An SSoAdvanced SYBR Green Supermix (Bio-Rad) in a total volume of 20 μL was used in a CFX96 thermocycler (Bio-Rad). The thermoprofile was 95°C for 15 seconds, 60°C for 30 seconds, consisting of 40 cycles followed by a dissociation curve. PCR primer (Sigma-Aldrich) sequences were:

• AXIN2 forward: 5′CAGATCCGAGAGGATGAAGAGA3′
• AXIN2 reverse: 5′AGTATCGTCTGCGGGTCTTC3′, giving an amplicon of 128 base pairs (bp).
• GAPDH forward: 5′ GGTGAAGGTCGGAGTCAAC 3′
• GAPDH reverse: 5′ CCATGGGTGGAATCATATTG 3′,²² giving an amplicon of 153 bp.

The GAPDH gene was used as an internal control. Because the ΔΔCt method compares the relative expression level of one sample to the other, a “reference” sample is required for analysis. To compare AXIN2 expression levels, one of the control samples was chosen as “reference” and its AXIN2 level was set at 100%. Then, every other sample was compared to this one to obtain their relative AXIN2 expression levels for statistical analysis. Therefore, the mean of the control group may not be exactly 100%. All experiments were performed in biologic replicates (cells from the same strain were plated onto multiple plates/wells).

Construction of the Recombinant Ad5 Adenoviral Vector

The Ad5-CMV-sFRP1 virus was constructed previously¹³ and was a kind gift from Alcon Research, Ltd. For the Ad5-CMV-DKK1 virus, we first cloned the human Dickkopf-related protein 1 (DKK1) cDNA (NCBI Gene ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_012242","term_id":"1519242912","term_text":"NM_012242"}}NM_012242) into the pGEMT vector (Promega). Then, the DKK1 sequence was cut at KpnI (5′) and SpeI (3″) sites, and inserted at the same sites into the pacAd5-CMV shuttle vector (Gene Transfer Vector Core, University of Iowa, Iowa City, IA). After sequence confirmation, the pacAd5-CMV-DKK1 vector was sent to the Gene Transfer Vector Core at the University of Iowa for Ad5-CMV-DKK1 viral production.

Intravitreal Injection and Mouse IOP Measurement

All animal procedures performed in our study complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and all protocols and regulations established by the Animal Care and Use Committee of Alcon Research, Ltd. and the University of North Texas Health Science Center. Adult male BALB/c mice (20–25 g body weight, 2–6 months old; Jackson Laboratories, Bar Harbor, ME) were housed in transparent plastic rodent boxes under 12-hour light/dark cycle with lights on starting at 6 AM. Mouse chow and water were available ad libitum. For intravitreal injections, the animals were anesthetized with a mouse anesthesia cocktail (intraperitoneal injection of ketamine 73 mg/kg, acepromazine 1.8 mg/kg, and xylazine 1.8 mg/kg). Adenoviral vectors of Ad5-CMV-NULL (as a negative control), Ad5-CMV-sFRP1 or Ad5-CMV-DKK1 (3 × 10⁷ PFU/eye) were injected intravitreally in a volume of 2 μL into a randomly-selected eye of each animal as described previously.¹³ The contralateral eye was not injected. IOP measurements of conscious animals were performed in a masked fashion using the TonoLab rebound tonometer (Colonial Medical Supply, Franconia, NH) as described previously.²³

The Existence of the Canonical Wnt Signaling Pathway in Primary HTM Cells

To confirm our findings in GTM-3 cells, we investigated further the Wnt pathway in two primary HTM cell strains. We cultured primary HTM cells, treated them with or without 100 ng/mL WNT3a and/or 2 μg/mL sFRP1 for 4 hours, and then extracted nuclear and cytosolic proteins for WB analysis. Similar to GTM-3 cells, WNT3a induced β-catenin translocation to the nucleus, which was inhibited by co-treatment with sFRP1 (Fig. 3A). These data suggested a functional canonical Wnt signaling pathway was present in primary HTM cells.

Open in a separate window

Figure 3

Existence of a functional canonical WNT signaling pathway in primary HTM cells. (A) Western blot of NE proteins and CE proteins from a primary NTM cell strain treated with or without WNT3a (100 ng/mL) and/or sFRP1 (2 μg/mL) for 4 hours. LaminA/C served as a nuclear protein loading control, while GAPDH served as a cytosolic protein loading control. Three different HTM strains were tested and representative data are shown. The OD of each β-catenin band was normalized first to laminA/C (for nuclear β-catenin) or GAPDH (for cytosolic β-catenin). They then were normalized to corresponding control (non-treated, which was set at 1.0), and the values are shown on the bottom of the Western blot. (B) Lentivirus-based luciferase assays of the canonical Wnt signaling pathway in primary NTM (white columns, left panel) and GTM (grey columns,right panel) cells. HTM cells were transfected with the lentiviral TCF/LEF reporter, and treated with or without 100 ng/mL WNT3a and/or 2 μg/mL sFRP1. Columns represent RLU. Data were analyzed by ANOVA and Bonferroni multiple comparison tests except for the comparison between columns 1 and 5 (from left to right), for which Student's t-test was used. Two different HTM strains were tested and representative data are shown. (C) Comparison of AXIN2 mRNA expression levels of primary NTM (white columns) and GTM (black columns) cells treated without or with 100 ng/mL WNT3a for 4 hours. Left panel: NTM cells. Right panel: GTM cells. Data were analyzed by Student's t-test. Columns and error bars: mean ± SD. **P < 0.010. ***P < 0.001.

We also performed luciferase assays in primary HTM cells. In contrast to GTM-3 cells, primary HTM cells are very difficult to transfect by plasmid vectors using conventional methods, which limits the application of plasmid-based luciferase assays in these cells. To circumvent this problem, we used a lentivirus-based luciferase assay system to study the Wnt/β-catenin signaling pathway. WNT3a (100 ng/mL) significantly induced luciferase expression in two HTM cell strains (one NTM and one GTM strain, P < 0.050, n = 5), and this induction could be blocked by co-treatment with 2 μg/mL sFRP1 (P < 0.050, n = 5, Fig. 3B). In addition, the basal Wnt signaling activity of the NTM cell strain was higher than that of the GTM cell strain (Fig. 3B, columns 1 vs. 5), supporting a previous study suggesting diminished Wnt signaling in GTM cells is due to higher endogenous levels of sFRP1.¹³

Besides luciferase assays, we also studied WNT3a-induced AXIN2 expression in the same primary HTM cells. AXIN2 expression levels were increased by approximately 3-fold in the two HTM cell strains treated with WNT3a (Fig. 3C, n = 3–4, P < 0.010).

The Wnt Pathway Ligands Did Not Affect Actin Cytoskeleton Organization in the TM

To determine whether IOP elevation in the human eye by exogenous sFRP1 was mediated by the noncanonical PCP-Rho-ROCK pathway, we treated primary HTM cells with WNT3a or SFRP1, and examined the organization of the F-actin cytoskeleton by immunofluorescence and the phosphorylation of MLC by WB.

We treated the primary HTM cells, including the NTM and GTM cell strains, with or without WNT3a or sFRP1 at two different concentrations. WNT3a had been shown to stimulate Rho activation and formation of stress fibers in other cells.²⁸ We included the ROCK inhibitor Y27632, which disrupts actin stress fibers, and the Rho activator LPA, which enhances the formation of actin stress fibers,^29,30 as negative and positive controls, respectively (Fig. 4, see Supplementary Fig. S1, available at http://www.iovs.org/content/53/11/7043/suppl/DC1).²¹ We found 1-hour (data not shown) or 24-hour (Fig. 4, see Supplementary Fig. S1, available at http://www.iovs.org/content/53/11/7043/suppl/DC1) treatment with either WNT3a or sFRP1 did not alter actin stress fibers in GTM (Fig. 4, see Supplementary Fig. S1, available at http://www.iovs.org/content/53/11/7043/suppl/DC1) or NTM cells (data not shown).

Open in a separate window

Figure 4

The organization of actin stress fibers was not affected by WNT3a or sFRP1. Primary GTM cells were treated with WNT3a (100 or 500 ng/mL), sFRP1 (2 or 10 μg/mL), Y27632 (10 μM), or LPA (20 μM) for 24 hours. Actin stress fibers were stained with phalloidin-Alexa-594. Neither WNT3a nor sFRP1 induced significant changes in actin stress fibers. For comparison, the ROCK inhibitor Y27632 disrupted actin stress fiber formation, while the Rho activator LPA enhanced actin stress fiber formation.

We also studied the effects of WNT3a and sFRP1 on the phosphorylation of MLC, which is a key component that regulates the TM actin cytoskeleton. Similarly, we treated primary HTM cells with or without WNT3a or sFRP1 at two different concentrations, and isolated whole cell lysates for WB analysis. We did not find any significant changes in MLC phosphorylation caused by WNT3a or sFRP1 (Fig. 5). In contrast, Y27632 inhibited MLC phosphorylation while LPA enhanced it (Fig. 5).

Open in a separate window

Figure 5

MLC phosphorylation was not affected by WNT3a or sFRP1. Primary GTM cells were treated with WNT3a (100 or 500 ng/mL), sFRP1 (2 or 10 μg/mL), Y27632 (10 μM), or LPA (20 μM) for 1 hour. WB of whole cell lysates was used for study MLC phosphorylation, as shown in (A). (B) Quantitative study of MLC phosphorylation. Double phospho-MLC (P-MLC) or total MLC was normalized first to GAPDH. Then, the amount of P-MLC was normalized to total MLC. Finally, the control was set at 100% and the other samples were normalized to the control. The paired Student's t-test was performed. *P < 0.050 compared to control.

These results suggested that PCP signaling is not stimulated by WNT3a or sFRP1 in the TM and that Wnt/β-catenin signaling is the major Wnt signaling pathway in these cells.

Alcon Research, Ltd. provided HTM cells, Y27632, and the Ad5-CMV-sFRP1 viral vector.