Characterizing VIP Neurons in the Barrel Cortex of VIPcre/tdTomato Mice Reveals Layer-Specific Differences

Fixation and Tissue Processing

The perfusion was done transcardially with 10% sucrose, followed by 150 mL of 4% paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.4. Brains were dissected out of the skull and postfixed for 2 h. Forebrain blocks for immunostaining were sectioned in the coronal plane on a vibratome (VT 1200S, Leica, Wetzlar, Germany) at 40 µm thickness. Brains for FISH underwent cryoprotection and were coronally sectioned with a cryostat (Cryo-Star HM560 MW, Thermo Fisher Scientific, Walldorf, Germany) at 40 µm thickness.

Immunohistochemistry

The sections were rinsed in Tris buffer (TB), 0.05 M Tris-buffered saline (TBS), and TBS containing 0.5% Triton X-100 (TBST; 2× 15 min each), all pH 7.6, and blocked with 10% normal goat serum (in TBST) for 90 min. The sections were then incubated for 48–72 h at 4 °C with one of the following primary ABs: rb-α-VIP 43841 (Abcam, Cambridge, UK) 1 : 1000, rb-α-VIP ImmunoStar 722001/20077 (ImmunoStar, Dietzenbach, Germany) 1 : 2000, rb-α-PV 25 (Swant, Marly, Switzerland) 1 : 5000, or rb-α-SOM T-4103 (Bachem, Bubendorf, Switzerland) 1 : 5000. The sections were subsequently rinsed in TBST (4× 15 min) and then incubated in Alexa Fluor 488-conjugated AB raised against rabbit IgG (goat anti-rabbit, 1 : 500, Life Technologies, Darmstadt, Germany) at room temperature (RT). After several washes with TBST, the sections were incubated with DAPI (1 : 1000, Life Technologies) and finally mounted in Aqua Poly-Mount (Polyscience, Warrington, USA).

Fluorescence In Situ Hybridization

FISH was performed with cRNA probes. The probes were generated from custom-manufactured plasmids (vector backbone: pGMT easy, Promega or pCR-Blunt II-TOPO, Invitrogen) containing cDNA inserts of the respective genes. Primer for DNA inserts: Gad1 (320 bp) forward primer (FP): GGCACGACTGTTTACGGAGC, reverse primer (RP): GCCTTGTCCCCGGTGTCATA; Slc17a7 (also known as vGlut1; 719 bp; Allen Brain Atlas Riboprobe ID: RP_050310_01_B09) FP: CAGAGCCGGAGGAGATGA; RP: TTCCCTCAGAAACGCTGG, (nested 296 bp) FPnested: GCTGGCAGTGACGAAAGTGA, RPnested: TGAGAGGGAAAGAGGGCTGG; Vip (527 bp; Allen Brain Atlas Riboprobe ID: RP_070116_02_E09) FP: CCTGGCATTCCTGATACTCTTC, RP: ATTCTCTGATTTCAGCTCTGCC, (nested 367 bp) FPnested: CTGTTCTCTCAGTCGCTGGC, RPnested: GCTTTCTGAGGCGGGTGTAG; Pvalb (434 bp) FP: ACGGCAAGATTGGGGTTGAA, RP: TCTCCTTGTGGGAAAGGTGC); Sst (514 bp; Allen Brain Atlas Riboprobe ID: RP_081204_01_A03) FP: ACGCTACCGAAGCCGTC; RP: GGGGCCAGGAGTTAAGGA. The plasmids were linearized with the appropriate restriction enzymes and served as templates for in vitro transcription using a DIG RNA labeling kit (Roche Applied Science, Mannheim, Germany). After blocking endogenous peroxidase with 1% H₂O₂ in methanol, sections were quenched with 0.2 M HCl, digested with proteinase K (20 µg/mL, Roche) in Tris–HCl/EDTA (50 mM/5 mM, pH 8), and finally postfixed in 4% PFA. Between all steps, sections were rinsed in PBS. After a treatment with 0.25% acetic anhydride (2.4/µL per mL 0.1 M triethanolamine/HCl) for 10 min, sections were rinsed twice in 2× standard saline citrate (1× SSC: 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0) and pretreated for 15 min in hybridization buffer (HB; 50% formamide, 4× SSC, 250 µg/mL of denaturated salmon sperm DNA, 100 µg/mL of tRNA, 5% dextransulfate, and 1% Denhardt's solution) diluted 1 : 1 with 2× SSC. The procedure was followed by 1 h of prehybridization at 55 °C in pure HB. DIG-labeled RNA probes (200 ng/mL) were hybridized overnight at 55 °C. The next morning, stringency washes were done in 2× SSC (2× 15 min, RT), 2× SSC containing 50% formamide (2× 30 min, at 65 °C), and 2× SSC (2× 5 min, at 65 °C). After RNase A treatment (4 µg/mL), the sections were rinsed again in 2× SSC (5 min, RT), 2× SSC containing 50% formamide (30 min, 65 °C), 0.1× SSC containing 50% formamide (15 min, at 65 °C), and finally with 0.1× SSC (2× 15 min, at 65 °C). The tissue was blocked with 4% sheep serum and 0.5% blocking agent (PerkinElmer). Hybridized probes were then incubated overnight with anti-DIG Fab fragments conjugated with peroxidase (raised in sheep; Roche) diluted 1 : 2000 in blocking agent containing 0.01 M TBS, pH 7.5. The AB signal was amplified using a Tyramide Signal Smplification Kit (TSA Biotin System NEL700001KT; PerkinElmer). Biotinyl tyramide working solution was incubated for 2 h. After rinsing in TBS, Streptavidin Alexa Fluor 488 (Molecular Probes; diluted 1 : 400 in TBS, 15 min) was used for detection of the covalently attached biotin.

Subsequent immunoamplification of the tdTomato signal was done with an anti-DsRed AB (anti-rabbit; 1 : 250; Clontech Laboratories, Mountainview, CA, USA) according to the standard IHC protocol (see above), but omitting the Triton treatment. The secondary AB was coupled with Alexa 546 (1 : 500; Life Technologies).

Image Acquisition and Data Analysis

All sections were imaged using an upright epi-fluorescence microscope (AxioImager.M2, Zeiss, Jena, Germany) using structured illumination (ApoTome, Zeiss). The set-up was controlled by the software Neurolucida (MBF Bioscience, Colchester, VT, USA). The barrel cortex and its layers were identified in acquired image stacks by DAPI stainings. Layer borders were determined according to the following cytoarchitectonic criteria: Layer I shows the lowest cell density, which easily distinguishes it from layer II/III. Layer IV can be identified by its cell-dense barrels. Layer V is characterized by a low density of large somata, whereas layer VI shows a high density of smaller somata that clearly separates these layers. Layer V can be subdivided into layer Va and b since layer Va consists of even fewer cell bodies (engaging approximately a third of layer V; Schubert et al. 2006). We analyzed 18 615 tdTomato-positive cells and 38 440 cells stained by IHC for PV (5739) or SOM (4089) and FISH with probes for Pvalb (7539), Sst (5514), and Gad1 (15559) in 150 sections from 12 animals. The density of cells was determined by normalizing data derived from the barrel cortex in each section to mm³. Thus, numbers for all cells or for cells from individual layers were scaled to 1 mm³ cortical tissue (including all layers; i.e., cells/mm³ cortex). For a detailed comparison of VIP cell density between layers, we used the number of cells within the given layer scaled to 1 mm³ of tissue of the respective layer (i.e., cells/mm³ layer X). For the results of the bin-size analysis, we used 20 bins; thus, the unit is 1/20th mm³ which is given as cells/0.05 mm³ (see Supplementary Fig. 1 for details).

In Vitro Electrophysiology

VIPcre/tdTomato mice were deeply anesthetized with isoflurane and decapitated. Thalamocortical slices (300 µm; Porter et al. 2001) containing the primary somatosensory (barrel) cortex were cut using a vibratome (Leica VT1200S). The cold (4 °C) cutting solution contained (in mM): 75 sucrose, 87 NaCl, 2.5 KCl, 0.5 CaCl₂, 7.0 MgCl₂, 26 NaHCO₃, 1.25 NaH₂PO₄, and 10 glucose, continuously equilibrated with 95% O₂ and 5% CO₂, pH 7.4. Slices were incubated for 0.5–1 h at 34 °C prior to recording in extracellular solution [artificial cerebro-spinal fluid (ACSF)] of the following composition (in mM): 125 NaCl, 2.5 KCl, 2 CaCl₂, 1 MgCl₂, 26 NaHCO₃, 1.25 NaH₂PO₄, and 25 glucose, pH 7.4 when equilibrated with 95% O₂ and 5% CO₂.

Slices were transferred to a fixed-stage recording chamber in an upright microscope (Axio Examiner, Zeiss) and continuously perfused at a rate of 2 mL/min with ACSF. All experiments were performed at 32 °C.

The barrel field was visualized at low magnification (×2.5) under bright-field illumination. Target neurons were identified by tdTomato fluorescence using a ×40 water immersion objective (×40/0.75 W, Olympus, Germany). For whole-cell patch-clamp recordings, filamented borosilicate glass capillaries (Science Products, Hofheim, Germany) of 5–8 MΩ resistances were filled with (in mM): 135 K-gluconate, 5 KCl, 10 HEPES, 0.5 EGTA, 4 Mg-ATP, 0.3 Na-GTP, 10 phosphocreatine phosphate, and 0.3–0.5% biocytin. Membrane potentials were not corrected for a liquid junction potential of approximately 16 mV. Membrane potentials were recorded using an SEC-05L amplifier (npi electronics, Tamm, Germany) in discontinuous current-clamp mode with a switching frequency of 50 kHz, filtered at 3 kHz, and digitized at 10–25 kHz using a CED Power1401 (CED Limited, Cambridge, UK). Access resistance was monitored and compensated if changes appeared. Recordings during which the access resistance could not be compensated were discarded. Data were collected, stored, and analyzed with the Signal 5 software (CED Limited). Passive and active properties of a neuron were determined immediately after reaching whole-cell configuration by applying 1 s long hyperpolarizing or depolarizing rectangular current pulses of varying strength at resting membrane potential.

Staining of Biocytin-Filled Cells

Staining of biocytin-filled cells has previously been described in detail (Staiger et al. 2004a, 2014). In brief, after recording slices were fixed in 4% formaldehyde (in PB) at 4 °C for 12–20 h. To stop fixation, the tissue was rinsed extensively with PB, including an intermediate step with 1% H₂O₂ (in PB) to block endogenous peroxidase activity. Next, slices were incubated in a cryoprotectant (25% saccharose and 10% glycerol in 0.01 M PB) for 1 h. They were freeze–thawed 3 times over liquid nitrogen. After 3 rinses in PB, the slices were incubated overnight with Avidin-Biotin Complex (ABC; 1 : 200; Vector, Burlingame, CA, USA) at 4 °C. Subsequently, 1 mg/mL of 3,3′-diaminobenzidine (DAB; Sigma, Deisenhofen, Germany) was preincubated for 10 min and the peroxidase was revealed by starting the reaction with 0.01% H₂O₂. The reaction was stopped by rinsing with PB. To intensify the reaction product, sections were dehydrated and cleared in xylene overnight and then rehydrated and incubated in 1.4% silver nitrate at 56 °C for 30 min, followed by 0.2% gold chloride at RT for 10 min, and fixed with 5% sodium thiosulfate for 5 min. The barrel field was visualized by cytochrome oxidase histochemistry.

Reconstruction of Biocytin-Filled Neurons

Neurons with consistently intense staining of neurites and no obvious truncation of processes were reconstructed using live digital images acquired by a digital camera (CX9000, MBF Bioscience) mounted on a microscope (Eclipse 80i, Nikon, Ratingen, Germany) with a ×63 oil immersion objective (NA = 1.4) and connected to a computer running Neurolucida (MBF Bioscience). Dendritic processes were distinguished from axonal structures by their diameter, fine structure, and branching pattern (see Supplementary Fig. 2 for details).

VIP-Expressing Cells Are GABAergic and Do Not Express PV or SOM

According to most previous studies in rodents, cortical VIP-expressing interneurons are GABAergic (Bayraktar et al. 1997; Gonchar et al. 2007; Zeisel et al. 2015). Thus, we tested for the presence of Gad1 RNA in RFP+ cells using FISH. 97.6% (2223.1 ± 283 of 2278.8 ± 284.2 cells/mm³ cortex; n = 6 animals, 18 sections) of all VIP cells were also labeled using a Gad1 probe (Fig. 2B). In contrast, FISH targeting RNA of the excitatory neuron marker Vglut1 showed no co-localization at all (n = 3 animals, 9 sections; Fig. 2C), suggesting that most, if not all, VIP neurons are GABAergic.

Of all Gad1-expressing neurons (16869.1 ± 1792 cells/mm³ cortex), a subpopulation of 13.2% also expressed VIP (2223.1 ± 283.0 cells/mm³ cortex). This proportion varied across layers: in layer I 8.4% (72.9 ± 19.7 of 885.1 ± 219.2 cells/mm³ cortex), in layer II/III 30.2% (1222 ± 140.6 of 4050.4 ± 473.2 cells/mm³ cortex), in layer IV 13.0% (528.3 ± 104.3 of 4036.9 cells/mm³ cortex), in layer Va 5.3% (91.9 ± 19.5 of 1773.5 ± 298.7 cells/mm³ cortex), in layer Vb 4.9% (128.6 ± 15.7 of 2686.5 ± 303.7 cells/mm³ cortex), and in layer VI 5.0% (177.9 ± 51.8 of 3442.4 ± 332.9 cells/mm³ cortex) of Gad1-expressing neurons also expressed VIP (see Supplementary Fig. 3).

As reported previously, the subpopulation of VIP-expressing interneurons does not overlap with other molecularly distinct major subpopulations, such as PV- or SOM-expressing interneurons (Rudy et al. 2011; Zeisel et al. 2015). To understand how distinct the population of VIP cells in the examined mouse model VIPcre/tdTomato is, we tested for co-localization of tdTomato and FISH with Pvalb (n = 6 animals, 18 sections; Fig. 2D) and Sst probes (n = 6 animals, 18 sections; Fig. 2E), respectively. We did not find a single overlap of these markers throughout the whole barrel cortex. The same results were obtained when using IHC with AB against PV (n = 6 animals, 16 sections; Supplementary Fig. 4C) and SOM (n = 6 animals, 18 sections; Supplementary Fig. 4D). Thus, these 3 protein markers distinguish the 3 major nonoverlapping subpopulations of GABAergic interneurons in VIPcre mice.

Distribution of Somata of VIP Neurons in the Barrel Cortex of VIPcre/tdTomato Mice

We quantified the distribution of VIP neurons in the barrel cortex of VIPcre/tdTomato mice in a layer-specific and a layer-independent (i.e., binned; see Materials and Methods and Supplementary Fig. 1 for details) manner (n = 12 animals, 150 sections; Fig. 3). Cell bodies were found throughout all layers of the barrel cortex with an overall number of 2226.4 ± 216.1 cells/mm³ cortex. Nevertheless, the distribution of these cells was not homogeneous across layers. In layer I, the number of VIP cells (44.6 ± 40.5 cells/mm³ cortex) was lowest compared with all other layers of the barrel cortex. Only 1.9% of all VIP cells were located in this compartment. We observed the highest number of fluorescent cells in layer II/III: 1366.6 ± 285.8 cells/mm³ cortex, which is 58.7% of all VIP cells in the barrel cortex. Layer IV was less populated (526.9 ± 168.95 cells/mm³ cortex or 22.6%). The number of VIP cells further decreased in layer Va. Here, only 103.8 ± 46.5 cells/mm³ cortex or 4.4% of all VIP cells were counted, followed by layer Vb with a similar count (119.0 ± 55.8 cells/mm³ cortex or 5.0%). Layer VI also contained a comparatively small number of VIP cells (172.4 ± 76.4 cells/mm³ cortex or 7.3%). The distribution of VIP cells was significantly different among all layers, except for layers Va and b (one-way ANOVA, H = 859.838, P < 0.001, post hoc Tukey analysis).

Open in a separate window

Figure 3.

Distribution of fluorescent somata of VIP-expressing cells in the barrel cortex of VIPcre/tdTomato mice shows a clear peak in layer II/III. (A) Projection view of an image stack visualizing the native fluorescence in a 300-µm thick coronal section (as an exception to better illustrate the distribution of RFP+ cells) through the barrel cortex of a VIPcre/tdTomato mouse. wm, white matter. (B) Bar graphs depicting the population analysis of the density of RFP+ cells (x-axis) in a layer-dependent (light red in cells/mm³ cortex; 12 animals, 150 sections) and layer-independent manner (dark red in cells/0.05 mm³; 12 animals, 150 sections). The density in each layer is significantly different from all others (one-way ANOVA, H = 983.520, P < 0.001, post hoc Tukey analysis), except for layers Va and b. For the layer-independent analysis, somata were counted in 20 bins of 50 µm ranging from the pial surface (0 µm) to the white matter border (1000 µm; y-axis; dark red bar graph). The location of layer borders was determined by identifying layers in DAPI stainings of 150 sections from 12 animals. Layer thickness was measured perpendicular to the pial surface. The resulting mean is shown as dashed lines in A and B (roman numerals depict layers; error bars = SD; scale bar = 150 µm).

Even though the previous paragraph shows a realistic estimate of the count of VIP cells per layer in 1 mm³ barrel cortex, differences in layer size prevent a direct comparison of cell densities between layers. To make this possible, we additionally calculated neuron densities per mm³ of the respective layer (cells/mm³ layer X; see Materials and Methods and Supplementary Fig. 1 for details). In layer I, the density of VIP cells was lowest (500.1 ± 445.9 cells/mm³ layer I). This increased to its maximum in layer II/III with 6432.4 ± 1163.5 cells/mm³ layer II/III. In layer IV, we observed 2692.3 ± 786.7 cells/mm³ layer IV. VIP cell density further decreased from layer Va (1175.7 ± 519.1 cells/mm³ layer Va) to Vb (910.2 ± 425 cells/mm³ layer Vb) and VI (617.6 ± 264 cells/mm³ layer VI). The density of VIP cells was significantly different between all layers, except for layers Va and b (one-way ANOVA, H = 663.938, P < 0.001, post hoc Tukey analysis).

To analyze the distribution of VIP cells independent of the more subjective layer borders, we subdivided the distance between pial surface and white matter into 20 bins and determined the density of VIP cells in each (Fig. 3B). The density of VIP-expressing cells rapidly increased throughout the first 3 bins from the pial surface downward from 62.6 ± 30.0 to an overall maximum of 402.0 ± 158.4 cells/0.05 mm³. From this peak, the density continuously decreased toward the white matter until it reached values below 100 cells/0.05 mm³, that is, 79.9 ± 42.1 cells/0.05 mm³, in the 10th bin. Further toward the white matter border, no major change in density was observed. The 20th bin contained the least amount of VIP cells with 50.9 ± 23.1 cells/0.05 mm³. This pattern was reflected in a significance analysis (one-way ANOVA, H = 983.520, P < 0.001, post hoc Tukey analysis). The first 3 adjacent bins were significantly different from one another, indicating a rapid increase in cell density to its peak in upper layer II/III. The decrease, however, seemed to be roughly continuous, because the density in neighboring bins from the third on toward the last was not significantly different from each other. Furthermore, the respective number of VIP cells in bins 12 (layer Vb) to 20 (lower layer VI) was not significantly different from the number of VIP cells in the first bin (layer I). This distribution corresponds well with most VIP cells being located in layers II/III and IV, whereas all other layers are less densely populated. Interestingly, the only distinct layer border reflected in the distribution pattern of VIP-expressing somata was between layers I and II/III. In addition, although the largest fraction of VIP cells is located in layer II/III (58.7%), a sizeable 41.9% of all VIP cells were found outside of this layer. As yet, these neurons have not been characterized to any significant extent.

Morphological Properties of Individual VIP Neurons

Because VIP neurons populate all layers of the barrel cortex and the spatial organization of these layers dictates the morphology of neurons, it is unlikely that this subgroup of GABAergic interneurons shows a similar morphology of somatodendritic and axonal arbors. In addition, different layers perform different functions (Harris and Shepherd 2015). To elucidate this in detail, we quantitatively analyzed the morphology of 18 individual VIP cells from all layers of the barrel cortex in VIPcre/tdTomato mice (layer I n = 1; layer II/III n = 8; layer IV n = 3; layer Va n = 2; layer Vb n = 3; layer VI n = 1; Figs 4–6; Supplementary Tables 1–3).

Open in a separate window

Figure 4.

Morphology and electrophysiology of VIP-expressing interneurons from layers I–II/III in the barrel cortex of VIPcre/tdTomato mice. (A) The reconstructed morphology of 5 individual VIP neurons is shown in a schematized barrel cortex. It is obvious that layer II/III VIP neurons (b–e) are similar to each other but very different from a layer I (a) neuron. Somata and dendrites are colored orange, and axonal processes green. In layer IV, the position of the home barrel for each neuron is depicted as dotted outlines, whereas dashed horizontal lines show layer borders. Individual neurons are labeled with lower case letters (layer borders as in Fig. 3; roman numerals indicate layers; wm, white matter; scale bar = 250 µm). (B) Magnified views of somatodendritic configurations for each neuron show multipolar (a), bipolar (c,d), and modified bipolar (b,e) patterns. Somata and first-order segments of the primary dendrites are colored in dark orange, higher order branches in a light orange, and axon in green (scale bar = 25 µm). (C) Electrophysiological recordings reveal a large diversity of membrane properties at rheobase (values in pA; upper traces) and in response to a hyperpolarizing current pulse of −50 pA. Dashed horizontal lines indicate the resting membrane potential. Action potential firing patterns (lower traces) show no correlation with the morphological properties. Note that the recordings for the neuron from layer I do not match the reconstructed cell. Abbreviations name the firing pattern after the Petilla convention (Ascoli et al. 2008; CA, continuous adapting; IS, irregular spiking; B, bursting; scale bars = 50 mV/250 ms).

Open in a separate window

Figure 6.

Somatodendritic and axonal morphology of VIP neurons from layer II/III is different from VIP neurons from layers IV to VI. (A) Reconstructions of the somatodendritic morphology of superimposed layer II/III VIP neurons show the restriction of the input compartment to layers I–III, whereas layer IV–VI neurons spread their dendritic arbors across all layers. (B) Axonal arbors show the opposite structural organization: Layer II/III axons spread across all layers of the barrel cortex, whereas layer IV–VI VIP neurons restrict their axon to the same layer compartment. The density of structures is visualized as heat maps ranging from red (most dense) to blue (least dense). Positions of somata are vertically aligned and marked as gray open circles. Eight VIP neurons from layer II/III are superimposed on the left, 9 from layers IV to VI in the middle, and all of these neurons merged including 1 layer I neuron are shown on the right in (A and B) (roman numerals depict layers; scale bar = 250 µm). (C) Box plots depicting significantly different features of dendrites and axons between the 2 tested groups (vertical spread of dendritic trees: 310.2 ± 50.5 vs. 523.8 ± 170.9 µm, U = 12.000, P = 0.024; amount of extralaminar dendritic arborizations: 24.6 ± 12.1% vs. 61.9 ± 21%, t =− 4.141, P < 0.001; vertical spread of axonal trees: 965.9 ± 95 vs. 499.7 ± 142 µm, t = 7.380, P < 0.001; see Supplementary Tables 1–3 for all tested parameters).

Somatodendritic Features

While VIP neurons were highly variable in most somatodendritic features, some were, however, invariant across the population. Somata of VIP neurons were predominantly elliptic (roundness = 0.62 ± 0.11; Supplementary Table 1) with a larger vertical diameter than a horizontal one (16.9 ± 2.3 and 11.0 ± 1.9 µm, respectively; Figs 4B and ​and55B; Supplementary Table 1). Somatodendritic configurations of VIP neurons were diverse and included [based on Bayraktar et al. (2000) and Ascoli et al. (2008)] 3 bipolar (Figs 4Bc,Bd and ​and55Ba), 6 modified bipolar (i.e., tripolar; Figs 4Bb,Be and ​and55Bb,Bc,Bd), 6 tufted (Fig. 5Be,Bf), 2 multipolar (Figs 4Ba and ​and55Bg), and 1 cell which did not fit into this nomenclature.

Open in a separate window

Figure 5.

Morphology and electrophysiology of VIP-expressing interneurons from layers IV–VI in the barrel cortex of VIPcre/tdTomato mice. (A) The reconstructed morphology of 7 individual VIP neurons is shown in a schematized barrel cortex. Somata and dendrites are colored orange, and axonal processes green. In layer IV, the position of the home barrel for each neuron is depicted as dotted outlines, whereas dashed horizontal lines show layer borders. Individual neurons are labeled with lower case letters (layer borders as in Fig. 3; roman numerals indicate layers; wm, white matter; scale bar = 250 µm). (B) Magnified views of somatodendritic configurations for each neuron show differences between bipolar (a), (bi-) tufted (e,f), modified bipolar (b–d), and multipolar (g) patterns. Somata and first-order segments of the primary dendrites are colored in dark orange, higher order branches in a light orange, and axon in green (scale bar = 25 µm). (C) Electrophysiological recordings reveal a large diversity of membrane properties at rheobase (values in pA; upper traces) and in response to a hyperpolarizing current pulse of −50 pA. Dashed horizontal lines indicate the resting membrane potential. Action potential firing patterns (lower traces) show no correlation with the morphological properties. Abbreviations name the firing pattern after the Petilla convention (Ascoli et al. 2008; CA, continuous adapting; IS, irregular spiking; HTBNA , high threshold bursting nonadapting; scale bars = 50 mV/250 ms).

A superimposition of all reconstructed VIP cells showed that their dendrites were found in all layers of the barrel cortex, distributed as follows: 16.3% in layer I, 37.9% in layer II/III, 12.5% in layer IV, 9.1% in layer Va, 12.8% in layer Vb, 10.2% in layer VI, and 1.2% in the white matter (Fig. 6A).

Interestingly, more than half of all dendritic branches were found in supragranular layers I and II/III, although we analyzed an equal number of VIP neurons from the upper and deeper layers of the barrel cortex. Does this mean that dendritic trees of supragranular VIP neurons differ from those of the deeper layers? Indeed, we found significant differences in the vertical spread and the amount of extralaminar branches of dendrites: VIP neurons from layer II/III had a vertically more restricted dendritic tree compared with deeper layer VIP cells (310.2 ± 50.5 vs. 523.8 ± 170.9 µm, U = 12.000, P = 0.024; Fig. 6A,C). Additionally, VIP neurons from layer II/III extended fewer dendrites into the layers outside their home layer (location of soma) than VIP neurons from layers IV to VI (24.6 ± 12.1% vs. 61.9 ± 21%, t = −4.141, P < 0.001; Fig. 6A,C).

Axonal Features

The morphology of axonal trees of VIP neurons was also highly variable among individual VIP neurons. Some features, however, remained consistent. In only 2 of 18 VIP neurons did the axon emanate from the soma itself (Fig. 5Bg). In 16 of the neurons, the axon originated from a first-, second-, or even third-order dendrite directed toward the white matter (Figs 4B and ​and55B). As a population, axonal ramifications were found in all layers of the barrel cortex (Fig. 6B). We analyzed several axonal features such as total length (8075.6 ± 3266.9 µm), number of nodes (116.3 ± 54.6), and horizontal (381.8 ± 205.2 µm) and vertical (690.5 ± 281.3 µm) spread. As with dendritic features, we compared axonal properties of layer II/III VIP neurons with those of layers IV–VI. Interestingly, only the vertical spread of axonal trees was significantly different: Layer II/III VIP neurons extended their axons across all layers of the barrel cortex, whereas layer IV–VI VIP neurons had more restricted axonal trees (vertical spread of 965.9 ± 95 vs. 499.7 ± 142 µm, t = 7.380, P < 0.001; Fig. 6B,C).

We also determined the number of axonal boutons of VIP neurons (2438.7 ± 1325.2; 29.3 ± 5.7 boutons per 100 µm axon) as well as their precise localization. In correlated light and electron microscopic studies, these structures were previously described as sites of presynaptic specializations (Staiger et al. 2004b; David et al. 2007). Thus, we analyzed their distribution profile across the barrel cortex. For layer II/III VIP neurons, most of the axonal boutons were found in 2 hot spots corresponding to layers II/III (42.8%) and Va (22.3%). The remainder was distributed as follows: 2.4% in layer I, 13.3% in layer IV, 13% in layer Vb, and 6% in layer VI. In contrast, VIP neurons located in deeper layers IV–VI showed a different distribution of axonal boutons. Most of these were found in layers Vb (43.9%) and VI (35.8%). Interestingly, no boutons were found in layer I and only few in layers II/III (0.4%), IV (10.6%), and Va (10.1%; Fig. 6B).

In summary, VIP neurons with their somata in layer II/III had slender axonal trees spreading across all layers of the barrel cortex with preferences for layers II/III and Va. VIP neurons with somata in deeper layers, however, showed more locally restricted axonal trees with preferences for layers Vb and VI.

Essentially, the layer targeting of both dendritic and axonal trees was heavily dependent on the location of the soma of VIP-expressing neurons in the barrel cortex of mice (Fig. 6; Supplementary Tables 1–3). This suggests that the 2 populations (layer II/III vs. layer IV–VI) possess distinct input and output domains.

Validation of the Cre-Driver Line as a Suitable Model System for Studying VIP Neurons

Specific targeting of VIP-expressing interneurons was very difficult in the past when these neurons were identified in nontransgenic approaches (Bayraktar et al. 2000; Cauli et al. 2000; Karagiannis et al. 2009). However, advances in the generation of transgenic mouse lines made VIP neurons more accessible. Early BAC-transgenic mouse lines had the disadvantages of either labeling VIP neurons as part of a larger population of neurons (ChAT-eGFP, von Engelhardt et al. 2007; GAD65-eGFP or G30, Xu and Callaway 2009; CR-eGFP, Caputi et al. 2009; Miyoshi et al. 2010) or being too unreliable in transgene expression (VIP-eGFP, own unpublished observation). Recently, a Cre-driver line for VIP was introduced, which promises a high degree of specificity and sensitivity (Taniguchi et al. 2011), but still required thorough characterization since previous studies were based on a low number of cells and confined to supragranular layers of the barrel cortex.

We used FISH and IHC to label VIP neurons in conjunction with Cre-driven tdTomato fluorescence. The almost perfect co-localization of fluorescence across all layers of the barrel cortex demonstrates the extensive sensitivity and specificity of this mouse line. In addition, FISH only labeled 89% of all tdTomato-expressing cells, whereas IHC labeled 99%. Thus, VIPcre/tdTomato mice seem to display VIP neurons more sensitive and specific than FISH or IHC could detect. We could also show that VIP neurons do not co-localize with the excitatory marker vGluT1, but indeed express Gad1 in the barrel cortex of mice, ruling out the possibility that at least some VIP neurons are excitatory (von Engelhardt et al. 2007; Wouterlood et al. 2008). The percentage of VIP neurons of the GABAergic neuron population was 13.2% and varied across layers. The highest percentage was observed in layer II/III, where 30.2% of all GABAergic neurons express VIP. In addition, VIP neurons never expressed molecular markers of other major populations of GABAergic neurons such as SOM or PV. These findings confirm and greatly extend previous data, thus enabling us to selectively and specifically study the properties of VIP neurons (Rudy et al. 2011; Lee et al. 2013; Pfeffer et al. 2013; Pi et al. 2013; Fu et al. 2014; Karnani et al. 2014).

VIP Neurons Show a Broad Spectrum of Morphological and Electrophysiological Properties

Our detailed analysis of the distribution of VIP neurons across the barrel cortex of mice revealed that VIP neurons are found in all layers. While the majority is found in layer II/III (∼60%), thus confirming earlier studies (Taniguchi et al. 2011), a large fraction (∼40%) is also found outside of this upper layer.

In this study, we show reconstructions of individual VIP neurons from all layers of the barrel cortex despite a low recovery rate of approximately 10%, which could be due to their small soma size. VIP neurons from the barrel cortex of mice show a much greater variability in morphological properties than the classical bipolar neuron described in the early literature (Morrison et al. 1984). Somatodendritic configurations are not restricted to bipolar, but also include tufted and even multipolar appearances.

Interestingly, the majority of axons of VIP neurons emanated not directly from the cell body, but from a dendrite extending toward the white matter. It has been shown that this structural organization has an impact on the efficacy of postsynaptic currents in different parts of the dendritic tree: Postsynaptic currents that are evoked in the dendritic tree carrying the axon have a greater impact on the generation of action potentials than those which have to pass the soma before arriving at the axon initial segment (Häusser et al. 1995; Thome et al. 2014). Since the axon of VIP neurons primarily originates at a dendrite oriented toward the white matter, the input to these dendrites might have more impact on spike generation than input to dendrites oriented toward the pial surface. Previous studies identified several sources of input onto VIP neurons: local pyramidal cells (Porter et al. 1998), thalamic fibers from the ventroposteromedial nucleus (Staiger et al. 1996), the basal forebrain (Fu et al. 2014), and cross-areal fibers (Lee et al. 2013). So far, little is known about the precise origin of synapses on the dendritic trees of VIP neurons. Nevertheless, axonal fibers from the motor cortex are considered to preferentially terminate in layer I. Some VIP neurons extend dendrites, which do not carry an axon into this layer. Thus, input from the motor cortex might not be as influential in driving VIP neurons as yet unidentified input to axon-carrying dendrites.

Membrane properties were similar, but not the same as was previously reported. We confirm that the most abundant firing pattern is continuous adapting (∼75%) as Karagiannis et al. (2009) showed. Their study also identified bursting VIP neurons which we found exclusively in layer II/III. In addition, we also observed irregular spiking and high threshold bursting nonadapting VIP neurons. Most membrane properties, however, were similar to those reported in rats (Porter et al. 1998; Karagiannis et al. 2009). Dissimilarities to prior reports from rats can be explained by methodological differences, such as identification of VIP neurons, number of cells analyzed, age of the animals, or analyzing techniques, and do not necessarily reflect interspecies differences.

Almost 60% of VIP neurons are located in layer II/III. Their appearance seems to be more homogeneous than that of approximately 40% of VIP neurons from other layers of the barrel cortex. Thus, we pooled data from VIP neurons from layer II/III and layers IV–VI, and compared these subgroups statistically: The morphology of layer II/III VIP neurons suggests that their dendritic tree is confined to layers I and II/III, whereas their axon is found across all layers of the barrel cortex. In contrast, dendrites of VIP neurons from layers IV to VI are found in all layers of the barrel cortex, whereas their axon is virtually confined to layers V and VI. Interestingly, none of the other morphological parameters tested were significantly different. This suggests that the structural organization or blueprint of dendritic and axonal trees is similar in every VIP neuron, whereas the distribution of these fibers is dependent on the location of the soma.

We also found differences in electrophysiological properties of layer II/III VIP neurons compared with the deeper layer neurons. VIP neurons from layer IV–VI are more hyperpolarized than those of layers II/III, which suggests that the latter are more easily excited. Furthermore, the amount of fast inward rectification is greater in the deeper layer VIP neurons. Fast inward rectification is a mechanism to stabilize resting membrane potentials in more hyperpolarized states. Thus, it is not surprising that VIP neurons in the deeper layers display greater fast inward rectification, while their resting membrane potential is more hyperpolarized. Interestingly, VIP neurons from layer IV to VI also show AHPs with larger amplitudes.

We thank Anna Dudek for help with the manuscript, Patricia Sprysch, Sandra Heinzl, and Anna Dudek for excellent technical assistance, and Anette Mertens and Adrian Villalobos for their help with the reconstructions. Conflict of Interest: None declared.