Phospholipase Cβ1 induces membrane tubulation and is involved in caveolae formation

The C-Terminal Domain of PLCβ1 Is Responsible for Tubulation of Liposomes.

Similar to other PLCs, PLCβ contains a catalytic core composed of an N-terminal PH domain, EF-hand motif, and the active sites X and Y, followed by a C2 domain (27). In addition to the catalytic X and Y domains, PLCβ is characterized by the presence of an extended C terminus of ∼400 amino acids (Fig. 3A). This C-terminal extension contains a highly conserved Gα_q binding site (28) and an elongated ∼300-amino acid coiled–coil domain (27). Whereas the PLCδ PH domain binds PIP₂ with high specificity and affinity, the binding of the PLCβ PH domain to the lipid is weak (29, 30). In contrast, the C-terminal extension is believed to be the primary membrane binding determinant in PLCβ (31–33). In Fig. 3 B and C, we show the effects of various C-terminal fragments of PLCβ1b on the binding to PE/PC/PS (6:2:2) MLVs and the tubulation of PE/PC/PS GUVs. The C2-Gα_q-Ctail and Gα_q-Ctail fragments selectively bound to PE/PC/PS MLVs, whereas C2-Gα_q bound both PE/PS/PC and PS/PC. In contrast, C2 alone did not bind MLVs, whereas Gα_q weakly bound PE/PC/PS MLVs. Although both C2-Gα_q-Ctail and Gα_q-Ctail specifically bound PE/PC/PS MLVs, only C2-Gα_q-Ctail efficiently induced tubulation of PE/PC/PS GUVs (Fig. 3C). Three other mutant proteins containing Gα_q slightly tubulated PE/PC/PS GUVs, whereas C2 domain alone did not exhibit tubulation. Far-red fluorescent protein mKate-conjugated C2-Gα_q-Ctail demonstrated the concentration of the protein to the tubules (Fig. 3D and Fig. S2). Fig. S2 shows that even in the spherical liposomes, mKate fluorescence was accumulated to one or several locations on the membrane surface, consistent with the observation in Fig. 2B. The mean maximum intensity of mKate-C2-Gα_q-Ctail was 4,577 ± 1,640 on the tube (n = 6) and 3,119 ± 2,874 on the spherical part of tubulated liposomes (n = 6), and 2,209 ± 1,339 on the smooth membrane of spherical liposomes (n = 12). This suggests that the C2-Gα_q-Ctail fragment accumulates and stabilizes the tubules shape.

Open in a separate window

Fig. 3.

C-terminal fragments of PLCβ1b induces tubulation of PE-containing liposomes. (A) Domain structures of PLCβ1b. (B) Binding of fragments of PLCβ1b to PE/PC/PS (6:2:2) and PC/PS (8:2) MLVs by floatation assay. (C) Tubulation efficiency of liposomes induced by the fragments of PLCβ1b (mean ± SD). (D) Distribution of mKate-C2-Gα_q-Ctail of PLCβ1b on PE/PC/PS (6:2:2) GUV. (Scale bar, 5 μm.) The arrowhead indicates a tubule.

Open in a separate window

Fig. S2.

Fluorescence image of the distribution of mKate-C2-Gαq-Ctail of PLCβ1b on PE/PC/PS (6:2:2) GUV. (Scale bars, 5 μm.)

Lyon et al. reported that C-terminal domains of PLCβ3 have the BAR domain-like structure (27). From the homology modeling (SWISS-MODEL) based on their PLCβ3 structure, C2-Gα_q-Ctail domains of PLCβ1 are revealed to form coiled coils and similar topology to BAR structure with positively charged clusters (Fig. S3). Homology modeling suggests that C2-Gα_q-Ctail of PLCβ1 is the BAR-like domain and generates/stabilizes the tubulation by a BAR modulating mechanism.

Open in a separate window

Fig. S3.

Homology modeling of PLCβ C-terminal structures. The homology modeling of PLCβ1, PLCβ2, and PLCβ4 were performed based on PLCβ3 (PDB ID code 4GNK) by SWISS-MODELL (57). The structures and electrostatic surface were processed by PyMOL (PyMOL Molecular Graphics System, version 1.7.6). The surface charge was indicated by red and blue.

Overexpression of PLCβ1b and the C-Terminal Fragment Induce Plasma Membrane Tubulation in Swiss 3T3 Cells.

Overexpression of BAR proteins (1) and fps/fes related-Cdc42-interacting protein 4 (FER-CIP4) homology-BAR (F-BAR) proteins (2) in cultured cells has been reported to induce plasma membrane tubulation. We used tetracycline-regulated expression system to highly express mKate-PLCβ1b and its derivatives in Swiss 3T3 cells. When cells were treated with doxycycline (Dox) to trigger tetracycline (Tet)-inducible expression systems, mKate-PLCβ1b induced plasma membrane tubulation (Fig. 4A, Left). In the absence of Dox, mKate-PLCβ1b was observed as the leaky expression, and located to the plasma membrane but did not induce tubulation (Fig. S4A). Likewise, mKate-PLCβ1b expressed by the plasmid containing the constitutive CMV promoter also did not induce tubulation (Fig. S4B). Similar to full-length PLCβ1b, the mKate conjugate of the phospholipase-dead mutant H331A/H378A (34) induced plasma membrane tubulation, indicating that phospholipase activity is not required for the induction of membrane tubulation (Fig. 4A, Center). In contrast, the mKate conjugate of a PLCβ1b mutant defective in C2-Gα_q-Ctail did not result in localization to the plasma membrane or membrane tubulation (Fig. 4A, Right).

Open in a separate window

Fig. 4.

Overexpression of PLCβ1b and C-terminal fragments induces the plasma membrane tubulations in Swiss 3T3 cells. (A) Fluorescence images of Swiss 3T3 cells overexpressing mKate-tagged full-length PLCβ1b, H331A/H378A mutant, and C2-Gα_q-Ctail-deficient mutant [Δ(C2-Gα_q-Ctail)] under the Tet-inducible system are shown. (B) Quantification of the localization of mKate-tagged PLCβ1b or those of its mutants under the Tet-inducible expression in Swiss 3T3 cells. (Lower) Representative patterns of the plasma membrane (red), cellular internal compartment (yellow), cytosol (green), and nucleus (blue). Results are the means ± SD of four independent experiments in which more than 100 cells were counted. (Scale bars, 20 µm.) (C) The effect of Tet-inducible overexpression of mKate-tagged PLCβ1b and its mutants on membrane tubulation in Swiss 3T3 cells. Results were scored as a percentage of the number of the transfected cells. Means ± SD of four independent experiments in which more than 100 cells were counted.

Open in a separate window

Fig. S4.

Lower-level expression of PLCβ1b in Swiss 3T3 cells. (A) The leaky expression of mKate-PLCβ1b with the plasmid containing Tet-inducible promoter in the absence of doxycycline (−Dox) and (B) constitutive CMV promoter expressing mKate-PLCβ1b are shown. Under both expressions, mKate-PLCβ1b localized to the plasma membrane but did not induce tubulation of the plasma membrane. mKate-PLCβ1b and differential interference contrast (DIC) are shown. (Scale bars, 20 μm.)

Fig. 4B summarizes the localization of the mKate conjugate of full-length PLCβ1b and its derivatives. Both full-length PLCβ1b and phospholipase-dead H331A/H378A mutants were exclusively located at the plasma membrane, whereas C2-Gα_q-Ctail-defective mutants were distributed in cellular internal compartments and the cytosol. Protein fragments that exhibited binding to the PE/PC/PS membrane (C2-Gα_q-Ctail, C2-Gα_q, Gα_q-Ctail, and Gα_q) (Fig. 3B) were localized to the plasma membrane. In contrast, the C2 and Ctail domains were either in cellular internal compartments or the cytosol. Fig. 4C indicates the percentage of cells that exhibited plasma membrane tubulation. Consistent with the model membrane study, C2-Gα_q-Ctail efficiently induced plasma membrane tubulation (Fig. S5A). The other fragments did not significantly induce tubulation.

Open in a separate window

Fig. S5.

Subcellular distribution of mKate- PLCβ1b derivatives in Swiss-3T3 cells. (A and B) Example of plasma membrane distribution (A) and internal structure distribution (B) of PLCβ1b derivatives. (A) The cell coexpressed mKate-PLCβ1b-C2-Gαq-Ctail (Left) and mTagBFP2-mem (Center). Colocalization indicates the distribution of mKate-PLCβ1b-C2-Gαq-Ctail to the plasma membrane labeled by mTagBFP2-mem. (B) The cell coexpressed mKate-PLCβ1b-C2 and mTagBFP2-mem. Dotty internal structures labeled by mKate-PLCβ1b-C2 (Left) are segregated from the mTagBFP2-mem (Center). (C) Example of nucleus distribution of PLCβ1b derivatives. Confocal image of cells expressing mKate-PLCβ1b-Ctail fusion proteins (Left). DIC image of the same specimen (Center). Green dotted line circles in the DIC image represent nucleus. Merge indicates this derivative was distributed in the nucleus. (Scale bars, 20 μm.)

Liposome Size Affects the Activity of PLCβ1.

It has been reported that membrane curvature affects the binding and insertion of various proteins (35). Ahyayauch et al. (36) reported that PLC from Bacillus cereus has a higher level of activity in smaller liposomes. To gain insight into the physiological role in the alteration of membrane curvature by PLCβ1, we compared the activity of PLCβ1a and PLCβ1b on freeze-thawed and extruded liposomes composed of PE/PC/PS/PIP₂ (6:2:2:1) (Fig. 5). The sizes and lamellarity of liposomes were examined using freeze–fracture electron microscopy (Fig. S6). The mean diameter of freeze-thawed liposome was 484 ± 200 nm (n = 23), and that of 100 nm pore-extruded liposomes was 102 ± 21 nm (n = 100). No multilamellar liposomes were observed in 100-nm liposomes, and fracture images in 4% of freeze-thawed liposomes showed membrane fragments derived from other lamellae, indicating multilamellar vesicles. To compare the lipase activity on these liposomes, the DAG production was quantified by MS. Both proteins showed higher activity on 100-nm liposomes than freeze-thawed liposomes, suggesting high curvature efficiently activates phospholipase activity of PLCβ1.

Open in a separate window

Fig. 5.

Liposome size affects the activity of PLCβ1. The amount of produced DAG was analyzed by MS with PLCβ1 and no treatment (non). Total DAG is the sum of each molecular species. Data were expressed as the absolute amount of DAG (mean ± SD). Significant differences (P < 0.05) were observed between a and b, a and c, and b and c.

Open in a separate window

Fig. S6.

Freeze–fracture of liposome Freeze–fracture electron microscopic images of freeze-thawed and extruded liposomes. (Scale bars, 200 nm.)

Preparation of Mouse Organ Extracts.

Each organ from C57BL/6 mouse (brain, liver, and heart; the protocol was approved by the institutional ethics committee.) was homogenized in 8 mL buffer A (25 mM Tris⋅HCl, 50 mM KCl at pH 8.5) containing protease inhibitor, using a tight-fitting glass/teflon homogenizer. The homogenate was centrifuged at 890 × g for 15 min at 4 °C. The sup was aliquoted and kept at −80 °C. Before experiments, the extracts were thawed on ice and centrifuged at 58,863 × g for 30 min at 4 °C, using a Beckmann Optima ultracentrifuge. The sup (1.76 mg/mL total proteins) was incubated with liposomes.

Liposome Sedimentation Assay for Binding Protein Screening.

MLVs were prepared by hydrating lipid film with buffer A and vortex mixing. Mouse brain extract (1.76 mg/mL total proteins, 100 μL) was incubated with MLVs (4 mM total lipids, 50 μL) for 30 min at room temperature. The mixture was centrifuged at 13,000 × g for 10 min at 4 °C, and the sediments of liposomes were washed twice with 150 μL buffer A. The collection of sup and pellet were subjected to SDS/PAGE, followed by Coomassie brilliant blue and silver staining. The protein band in the SDS/PAGE was excised and in-gel digested with trypsin. The resulting peptides were extracted and analyzed by MALDI-TOF/MS (RIKEN Bio-Material Analysis). The protein was identified by peptide mass fingerprinting, using the Mascot search program (Matrix Science).

Preparation of GUVs.

GUVs were formed by the gentle hydration method (9). In brief, the lipid film was hydrated with 150 mM sucrose for 2 h at 50 °C. GUVs were diluted with buffer A or TBS (20 mM Tris⋅HCl, 140 mM NaCl).

Darkfield Microscopy for Tubulation Experiment.

GUV suspension (200 μM, 5 μL) was mixed with an equal volume (5 μL each) of the organ extract (final, 0.88 mg/mL) or purified proteins (200 nM full-length PLC and 2 μM PLC fragments) in a glass flow cell (9) unless otherwise described. To prevent the GUV solution drying by evaporation, the sample flow cell was sealed with VALAP (Vaseline:lanolin:paraffin = 1:1:1; TI Factory). Shape change of liposomes was observed under high-intensity darkfield microscope (Eclipse E600; Nikon) equipped with 100× objective (N.A. = 0.5–1.3) and darkfield condenser (N.A. =1.0–1.4). Images were acquired with ORCA-Flash 4.0 sCMOS camera (Hamamatsu Photonics) and processed with Image J (NIH). Simultaneous observation of darkfield and epifluorescence image was performed with the same objective and the green excitation filter unit (G2A; Nikon). Distribution of mKate-C2-Gαq-Ctail of PLCβ1b on PE/PC/PS (6:2:2) GUV was quantified by the measuring of the maximum fluorescence intensity of tubules, the spherical part of the tubulated liposome, and the smooth membrane of spherical liposome. The intensity was corrected by subtracting the background. The glass surface was siliconized using the “wipe-on” the method of SurfaSil Siliconizing Fluid (Pierce Biotechnology).

In our GUV sample, most of the liposomes exhibit a spherical shape, although there were minor populations of tubules. These tubules were not counted. After the addition of PLCβ1 or fragments of PLCβ1, tubules were developed from spherical liposomes. We judge that GUVs are tubulated when the length of tubules is longer than 2 μm and the tubules are connected to GUVs whose diameter is more than 2 μm. This definition excludes the preexisting tubules that do not connect to spherical liposomes. Multiple tubulations from one liposome were counted as one tubulation. One hundred randomly selected images were acquired to quantitate tubulation. Three independent experiments were performed for statistical analysis.

Production of PLCβ1a and PLCβ1b by Insect Cells.

The full-length cDNA clones for human PLCβ1a and PLCβ1b were isolated from a human cDNA library (Agilent Technologies Inc.). The Bac-to-Bac Baculovirus Expression System (Invitrogen) was used to express the recombinant human PLCβ1a and PLCβ1b with His-tag on the N-terminal in Spodoptera frugiperda (Sf21) cells. The recombinant proteins with His-tag were purified as described previously (52).

Preparation of Plasmids.

The following partial constructs were amplified from human PLCβ1b cDNA by PCR, using primers that contain KpnI (5′ primer) and EcoRI (3′ primer) sequences: ∆(C2-Gαq-Ctail), 1–676 aa; C2-Gαq-Ctail, 677–1,173 aa; C2- Gαq, 677–1,141 aa; C2-Gαq-∆C, 677–1,024 aa; Gαq-Ctail, 792–1,173 aa; C2, 677–791 aa; Ctail, 1,024–1,173 aa; Gand αq, 792–1,141 aa. Point mutations H331A and H378A were generated by PCR mutagenesis, using the two-step PCR amplification method with the following oligo nucleotide pairs: H331A, ggtaggtgttgGCcgaggaattaatg and cattaattcctcgGCcaacacctacc; H378A, catggtgaagccaGCggtgatgac and gtcatcaccGCtggcttcaccatg. Generated fragments were cut out by restriction enzyme digestion and cloned into pTRE2 plasmid (Clontech) containing a mKate fragment amplified from pmKate-C1 (Evrogen, Inc.) to generate N-terminal mKate-tagged constructs.

The plasma membrane marker plasmid (mTagBFP2-mem) was constructed as follows: mTagBFP2 fragments were prepared by PCR-based mutagenesis from pmKate-C (Evrogen), following the previously reported sequence data (53). The mTagBFP2 fragments were replaced with EGFP fragment of pEGFP-C1 vectors (Clontech) by using BglII and NheI site. The sequence encoding plasma membrane marker (farnesylation signal sequence from the C-terminal sequence of H-Ras, KLNPPDESGPGCMSCKCVLS) was amplified from pmTagBFP2-C1 with primer pair mTagBFP2-F (5′- TCCGCTAGCGCTACCGGTCGCCACCATGTCTGAAGAGCTGATTAAGGAG -3′) and mTagBFP2-R (5′- GCAGAATTCTCAGGAGAGCACACACTTGCAGCTCATGCAGCCGGGGCCACTCTCATCAGGAGGGTTCAGCTTAGATCTGAGTCCGGAATTAAGTTTGTG-3′) by PCR. The PCR fragment was replaced with EGFP by using EcoRI/NheI sites of pEGFP-C1. The resulting plasmid was verified by DNA sequencing.

Production of PLCβ1b Fragments by Escherichia coli.

The following partial constructs of PLCβ1b were cloned into the KpnI/EcoRI site of the expression vector pCold (TaKaRa Bio): C2-Gαq-C-tail, 677–1,173 aa; C2, 677–791 aa; Gαq-Ctail 792–1,173 aa; Gαq, 792–1,141 aa; C2-Gαq, 677–1,141 aa; and Ctail, 1,024–1,173 aa. All constructs were expressed using E. coli BL-21 as a host. Expression of amino-terminally His6-tagged proteins was performed at 16 °C for 24 h, according to the manufacturer's instructions, using a pCold system. The bacteria were collected by centrifugation, and then the pellet was sonicated with 1 mg/mL lysozyme in 20 mM Hepes at pH 7.5, containing 0.5 M NaCl on ice. After the extract was cleared by centrifugation, the supernatant was applied to a nickel-Sepharose Fast-Flow column (GE Healthcare); washed with 20 mM Hepes (pH 7.5), 0.5 M NaCl, and 20 mM imidazole at pH 7.4; and eluted with 20 mM Hepes (pH 7.5), 0.5 M NaCl, and 0.5 M imidazole, using the AKTA system (GE Healthcare). The expression of recombinant proteins was determined by SDS/PAGE. The recombinant proteins were concentrated using Amicon Ultra-15 (Millipore) against 20 mM Hepes (pH 7.5), 0.15 M NaCl, and 5% (vol/vol) glycerol; divided into aliquots; and kept frozen. After ultrafiltration, the concentration of the proteins was determined by a Biorad protein assay kit. BSA was used as a standard.

Liposome Flotation Assay.

MLVs (1 mM total lipids, 450 μL) containing 0.05 mol% N-nitrobenzoxadiazole (NBD)-PE were incubated with proteins (450 μL) at room temperature for 30 min. This suspension was mixed with 1 mL of 2.1 M sucrose in PBS, loaded at the bottom of an ultracentrifuge tube (MLS50; Beckman Coulter), and overlaid with 1.5 mL of 1.2 M sucrose and 2.25 mL of 0.8 M sucrose. The gradient was centrifuged for 1 h at 35,608 × g at 4 °C, using a Beckman Coulter Optima ultracentrifuge. The top fraction (200 μL) was collected and subjected to SDS/PAGE and Western blotting [first antibody: rabbit anti-PLCβ1 IgG (sc-9050; Santa Cruz Biotechnology); second antibody, HRP-conjugated anti-rabbit IgG, detected by a ECL prime detection kit (GE Healthcare)]. The band intensity was compared with that of input. Fluorescence intensity of N-NBD-PE was measured (excitation 488 nm, emission 533 nm) to monitor the position and concentration of liposomes in the gradient.

ELISA Measurement of PLCβ1b Binding to Various Lipids.

ELISA was performed as described previously (54). In brief, 50 μL lipid (10 μM) in ethanol was added to each well of microtiter plate (Immulon 1; Dynatech Laboratories). After solvent evaporation at room temperature, 100 μL of 30 mg/mL BSA in TBS (10 mM Tris⋅HCl at pH 7.4, 150 mM NaCl) was added to each well. After washing, the wells were incubated with 50 μL PLCβ1b solution in TBS containing 10 mg/mL BSA for 1 h at room temperature. The bound proteins were detected by incubating with peroxidase-conjugated streptavidin. The intensity of the color developed with o-phenylenediamine as a substrate was measured with a Molecular Devices, Spectra Max M2 (absorption at 490 nm).

Culture of Swiss 3T3 Cells.

Swiss 3T3 cells were stably transformed with a “reverse” Tet-regulated transcriptional activator construct (BD Biosciences Clontech) to generate stable Tet-On cell lines. Generated Tet-On cells were maintained in alpha-MEM supplemented with 10% (vol/vol) FCS (Tet approved; Clontech), 100 μg/mL G418 sulfate, 10 U/mL penicillin, and 100 μg/mL streptomycin. For induction, cells were transiently transfected with the pTRE2- PLCβ1 or its derivative plasmids (2 µg; BD Biosciences Clontech) by lipofectamine LTX (Invitrogen). After 24–36 h, 10 μg/mL Dox was added. After 48 h of induction, cell mKate fluorescence was examined under the confocal microscope.

Confocal Microscopy.

Confocal images were obtained on a Zeiss 700 confocal microscope equipped with a C-Apochromat 63XW Korr (1.2 NA) objective with the optical section set to ∼0.5 μm. For counting cells showing tubulation, cells were fixed with 4% (wt/vol) paraformaldehyde and then were applied to fluorescent microscopy. Cells with five or more inward tubulations were counted as cells showing tubulations. The data represent the ratio of cells showing tubulation versus total cells expressing PLCβ1 derivatives. The localization of PLCβ1b derivatives was classified as follows: plasma membrane, cellular internal compartments, cytosol, and nucleus.

The pattern of plasma membrane represents that cells display the cell surface signal of mKate and there was a greater than 1.5-fold enrichment of the average of fluorescence intensity (AFI) of the mKate signal at the cell surface compared with AFI in the cytosol, using the following equation: (AFI of cell surface − AFI of background)/(AFI of cytosol − AFI of background). AFI of background and cytosol were calculated from the intensity of each 5 μm² area. The plasma membrane localization was further confirmed by measuring colocalization with a mTagBFP2-mem-encoding farnesylation signal that targets the protein to the plasma membrane (Fig. S5A).

The localization was categorized as cellular internal compartments if the PLCβ1b derivatives do not display cell surface signal of mKate, but contain five or more mKate-positive structures whose sizes are larger than 2 μm in the cytosolic space, with the exception of the nucleus and inward tubulation (Fig. S5B).

The localization was categorized as cytosol if the PLCβ1b derivatives display no obvious mKate-positive signal in cell surface and there were four or fewer structures whose sizes are larger than 2 μm in the cytosolic space.

Finally, the localization was categorized as nucleus if cells do not display any mKate pattern categorized into cell surface and cellular internal compartments, but display round or elliptic structures overlapping with nucleus observed in the differential interference contrast images (Fig. S5C).

Measurement of PLCβ1 Activity on Different-Sized Liposomes.

Liposomes composed of POPE/POPC/POPS/PIP₂ = 6/2/2/0.1 containing 1% tocopherol were prepared by freeze–thawing three times, and then the aliquot of liposomes was extruded through 100-nm pore membranes (miniextruder; Avanti Polar Lipids). The sizes and lamellarity of liposomes were examined using freeze–fracture electron microscopy in addition to dynamic light scattering (Zetasizer Nano ZS). Reaction mixtures (100 μL) containing liposomes (final 0.55 mM total lipids) and PLCβ1 proteins (final 35 μg/mL) in buffer A were incubated for 10 min at 37 °C. The reaction was stopped by the addition of 300 μL methanol and produced DAG was quantified by MS.

Quantification of DAG by MS.

An Agilent 1100 series LC (Agilent Technologies) coupled with a 4000 QTRAP hybrid triple quadrupole mass spectrometer (AB SCIEX) was used for MS analysis of DAG molecular species. After treatment with PLC, internal standards for DAG (D-5 DAG mix and 1,2-dioctanoyl-sn-glycerol; Avanti) was added, and lipids were extracted. Each molecular species of DAG was analyzed by flow injection MS analysis. The optimal conditions for the ionization and the fragmentation of each DAG were determined. MS analysis was run in the positive ion mode with the following instrument parameters: curtain gas of 10, ion spray voltage of 5,500, temperature of 450, nebulizer gas of 40, auxiliary gas of 30, and collision cell exit potential of 10. The levels of declustering potential, entrance potential, and collision energy were optimized for each target. Multiple-reaction monitoring mode was used to measure the DAG-containing different acyl chains. Each ion pair of DAG species in multiple-reaction monitoring was measured for 100 ms with a resolution of the unit. DAG contents were calculated by relating the peak area of each species to the peak area of the corresponding internal standard and the standard curve of each internal standard (0–100 pmol). Data acquisition and analysis were performed using Analyst Software version 1.4.1 (AB SCIEX). MS data are reported as means ± SD. Statistical analyses were performed by one-way analysis of variance (ANOVA) with Dunnett’s test to identify levels of significance between the groups.

Knockdown of PLCβ1.

siRNA sequences directed against mouse PLCβ1, #564–586 (sense strand, 5′-CACUAGAGGCUUGUAGUCUUC-3′; antisense strand, 5′-AGACUACAAGCCUCUAGUGCA-3′) and #1,279–1,301 (sense strand, 5′-GUAUUGCCGAUUAAUCUUUGG-3′; antisense strand, 5′-AAAGAUUAAUCGGCAAUACUC-3′), were designed using the siDirect program at the website of RNAi Inc. (www.rnai.co.jp/lsci/top.html). These siRNAs and negative control were purchased from the company. A knockdown experiment was carried out as below. One day before transfection with the siRNAs, Swiss 3T3 cells were seeded in a 6-cm dish in 3.75 mL DMEM supplemented with 10% (vol/vol) FBS without antibiotics and cultured at 37 °C overnight. After the addition of 750 µL Opti-MEM I medium (Invitrogen) containing 45 pmol siRNA (final 10 nM) complexed with Lipofectamine RNAiMAX (Invitrogen), the cells were further cultured at 37 °C for 48 h. The knockdown of PLCβ1 was confirmed by Western blotting with an anti-PLCβ1 antibody.

We thank Prof. Michael Kozlov of Tel Aviv University and Prof. Hiroshi Takahashi of Gunma University for their valuable comments. T.I. and T. Kishimoto are especially grateful to Ayumi Inaba and Mami Kishimoto, respectively, for encouragement during this work. T.I. and T. Kishimoto were supported by the Special Postdoctoral Fellows program of RIKEN. Mouse Swiss Albino embryo fibroblast Swiss 3T3 cells were provided by the RIKEN BRC through the National Bio-Resource Project of the Ministry of Education, Culture, Sports, Science and Technology, Japan. This work was supported by Integrated Lipidology Program of RIKEN, RIKEN President’s Fund “4D Measurements for Multilayered Cellular Dynamics,” Grant-in Aid for Scientific Research 23790115 (to A.M.), 23590251 and 15K08167 (to M.M.), 24770135 (to T. Kishimoto), and 22390018 and 25293015 (to T. Kobayashi) from the Ministry of Education, Culture, Sports, Science and Technology of Japan and Naito Foundation.