Penicillium chrysogenum polypeptide extract protects tobacco plants from tobacco mosaic virus infection through modulation of ABA biosynthesis and callose priming

RNA extraction and transcriptome analysis via RNA-seq

For RNA-seq, leaves were harvested at 7 d post-inoculation (dpi), combined into one composite sample, and then flash-frozen in liquid nitrogen. Each treatment consisted of three biological replicates. Total RNA was extracted using TRIzol reagent (Takara, Tokyo, Japan) according to the manufacturer’s instructions. The RNA quality and purity were assessed using NanoDrop 2000 (Thermo, Waltham, USA) and an Agilent 2100 (Agilent Technologies, CA, USA) system based on an RNA integrity number (RIN) of at least 8.0. Transcriptome sequencing was performed using the high-throughput Illumina HiSeq 4000 sequencing platform (Illumina, San Diego, CA, USA).

RNA-seq data analysis

The reference genome used to analyse our RNA-seq data was version Niben101, and was obtained from ftp://ftp.solgenomics.net/genomes/Nicotiana_benthamiana/. Based on the selected reference genome sequence, the mapped reads were combined via StringTie or Cufflinks software. The mapped reads were compared with the original genome annotation information to identify the original unannotated transcription region and to discover new transcripts and new genes of the species to supplement and improve the original genome annotation information. The differentially expressed genes (DEGs) were identified based on their fragments per kilobase per million reads (FPKM) via RSEM (RNA-Seq by Expectation-Maximization; Krylov et al., 2003). DEGs with an adjusted P value ≤0.05 and log₂(fold change) (log₂FC) ≥1 were used to identify the number of DEGs in the different treatments. DESeq2 was subsequently used to determine the false discovery rate (FDR) threshold (adjusted P value). The FDR in the multigroup comparison was less than 0.05, and this value was considered to indicate significantly different expression.

Quantitative real-time polymerase chain reaction (qRT–PCR)

Total RNA was obtained from leaves using TRIzol reagent (Takara, Tokyo, Japan). The RNA was then reverse transcribed into cDNA using PrimeScript™ RT Master Mix (Takara, Tokyo, Japan). The cDNA content was subsequently measured via an ABI 7500 system (Thermo, Waltham, MA, USA) in conjunction with SYBR™ Green PCR Master Mix (Thermo, Waltham, MA, USA). The cycle threshold (CT) values of the target genes were normalized to the CT value of β-actin/EF1α/F-box. The PCR conditions were as follows: 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The relative expression was analysed according to the 2^−ΔΔCt method. The sequence data for ABA2 ({"type":"entrez-nucleotide","attrs":{"text":"EU123520.1","term_id":"159517159","term_text":"EU123520.1"}}EU123520.1), ZEP ({"type":"entrez-nucleotide","attrs":{"text":"XM_016582459.1","term_id":"1025404695","term_text":"XM_016582459.1"}}XM_016582459.1), β -actin ({"type":"entrez-nucleotide","attrs":{"text":"AB158612","term_id":"50058114","term_text":"AB158612"}}AB158612) and β -1,3-glucanase (Niben101Scf01001g00005) were retrieved from the NCBI data libraries. The relative expression of the target genes was normalized to those of multiple endogenous control genes, such as the β -actin, EF1α, and F-box genes (Nakano and Mukaihara, 2019). The primers used for qRT–PCR are listed in Supplementary Table S1.

TMV visualization

An Agrobacterium strain [Agro-p35s-m30B: green fluorescent protein (GFP)] harbouring TMV was donated by Professor Xiaoying Chen from the Institute of Microbiology, Chinese Academy of Science. The GFP fluorescence of the TMV-inoculated plants was observed under a handheld UV lamp (365 nm; Model sb-100 p/FA, Spscientific, USA), and the plants were imaged with a digital camera (Canon 500D, Canon, Japan). The GFP fluorescence of the plants was quantified using ImageJ 2x software.

CRISPR/Cas9

CRISPR/Cas9 pP1C vectors were purchased from Genloci Biotechnologies Inc. (Cat. No. GP0143, Nanjing, China). The experiments were performed according to the manufacturer’s instructions. The sequence of the target for CRISPR/Cas9-induced mutations of N. benthamiana ZEP is ‘GCTGCCTTTATTGATCTCTAAGG’. ZEP from mutations was amplified and sequenced for verification using the forward primer 5′-ATGTATTCAACTGTGTTTTACACTT-3′ and reverse primer 5′-ACCAGTTACCAGAAACACCATCAAC-3′.

Plant transformation and mutation analysis

pP1C.4 vectors containing gRNA and Cas9 expression cassettes were transformed into Agrobacterium tumefaciens GV3101 according to the freeze-thaw method. The positive clones were then used to produce NbZEP mutant N. benthamiana via the Agrobacterium-mediated leaf disc transformation technique (Pathi et al., 2013; Hudzieczek et al., 2019). Hygromycin-resistant seedlings were obtained, and the mutants were subsequently identified using PCR amplification and Sanger sequencing. gDNA was extracted from the T₀ transgenic plants via a MiniBEST Plant Genomic DNA Extraction Kit (Takara, Tokyo, Japan). For the detection of mutations, the genomic regions that included the Cas9/gRNA target sites were amplified via PCR in conjunction with specific primers (see CRISPR/Cas 9 methods). The PCR products were then cloned into T vectors by using a pEASY-T5 Zero Cloning Kit (TransGen, Beijing, China), and the positive clones were sequenced via Sanger sequencing. The resulting reads were aligned with wild-type sequences for the detection of candidate mutant lines using DNAMAN 8.0 software (Lynnon Biosoft Company, USA). To investigate the inheritance of CRISPR/Cas9-induced targeted NbZEP modifications in subsequent generations, three T₀ plants with biallelic mutations were self-pollinated, and the resulting T₁ plants were then transplanted into soil and grown to maturity. Mutant tobacco lines were identified genetically according to the above-described method. The mutant T₂ plants were then used for further analysis.

Quantification of ABA using ELISA

Leaves of wild-type N. benthamiana and the ZEP mutant were collected. The ABA concentrations in the leaf tissue homogenates were measured with a plant ABA ELISA kit (Mlbio, Shanghai, China), and the experiment was performed according to the manufacturer’s instructions. The optical density (OD) value of the samples at 450 nm was measured with a microplate reader (SpectraMax iD5, Molecular Devices, USA).

Aniline blue staining

Aniline blue staining of callose was performed as described by Conrath et al. (1998). Leaves were placed in a phenol solution (water: glycerine: phenol: lactic acid, 1:2:2:1 mass mixture), boiled for 2 min, and then subjected to three 5 min washes with distilled water. The clarified leaves were then dyed with 0.01% aniline blue solution (in 0.1 M PBS; pH 7.0) for 15 min and subsequently washed three times (5 min each) with distilled water, after which they were imaged under an ultraviolet excitation filter (BP 330–385 nm) via a fluorescence microscope (BX50, Olympus, Japan). The experiment was performed three times. The turquoise fluorescence was regarded manually as the regions of interest (ROI) for quantification. Callose deposition was quantified by turquoise fluorescence of callose deposits using ImageJ 2x software. The ‘Freehand selections’ or ‘Magic wand’ was used to define the area of a callose deposit, and ‘Histogram list’ as the reference for calculating fluorescence intensity (Ellinger et al., 2013). Average callose measurements were based on at least six photographs from different leaves.

Western blot assays

The total protein of leaves was extracted with a Plant Protein Extraction Kit (Solarbio, Beijing, China) and quantified via a BCA Protein Assay Kit (Beyotime, Shanghai, China). Following this, 40 µg of protein was loaded onto 10% SDS-PAGE gels; following electrophoresis the proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, USA), and the membranes were blocked with 5% skimmed milk powder at 4 °C for 3 h. The membranes were subsequently incubated together with anti- β -1,3-glucanase antibodies (AS07-208; 1:200, Agrisera, Sweden) and anti-plant Rubisco antibodies (QYA00813A, 1:2000; Beijing Qualityard, Beijing, China) overnight at 4 °C, after which they were incubated together with HRP-conjugated goat anti-mouse IgG (QYB001; 1:5000; Beijing Qualityard, Beijing, China) or HRP-conjugated goat anti-rabbit IgG (QYB002; 1:5000; Beijing Qualityard, Beijing, China) for 2 h at 4 °C. The protein fragments were observed with an enhanced chemiluminescence (ECL) kit (Millipore, USA) under a chemiluminescence imaging system (ChemiDoc XRS+, Bio-Rad, USA). The fragments were analysed and quantified via ImageJ 2x software.

Transmission electron microscopy immunolocalization

The leaves were cut into 1×3 mm pieces that were then placed in a fixation solution consisting of 4% paraformaldehyde and 0.1% glutaraldehyde for 2 h at 4 °C. The samples were then subjected to three 10 min washes with 0.1 M PBS, after which they were dehydrated using different concentrations of ethanol (30% for 30 min, 50% for 30 min, 70% for 1 h, 90% for 1 h, 100% for 3 h, changing the 100% ethanol every hour) at 4 °C. The leaves were subjected to three additional 10 min washes with 0.1 M PBS, permeated with ethanol: K4 M resin (1:3) for 1 h and then ethanol: K4 M resin (1:1) for 3 h, embedded in pure K4 M resin for 24 h at 4 °C, polymerized at –20 °C for 72 h, and then kept at 25 °C for 48 h in a UV polymerization box (Electron Microscopy China, Beijing, China). The embedded mass was sliced into semi-thin sections to observe the location, after which 90 nm ultrathin sections were cut with an ultramicrotome (EM UC7, Leica, Germany) and collected on formvar-coated Au grids (Electron Microscopy China, Beijing, China). The sections were subjected to three 5 min washes with 0.1 M PBS and double-distilled water, and then blocked in 1% bovine serum albumin (BSA) at 25 °C for 30 min. The sections were incubated together with anti-β-1,3-glucan antibodies (1:100; G7527; Biosupplies, Parkville, Australia) or anti-β-1,3-glucanase antibodies (1:50; AS07-208; Agrisera, Sweden) at 37 °C for 2 h, and then subjected to three 5 min washes with 0.1 M PBS and double distilled water. The sections were subsequently incubated together with anti-mouse IgG/Gold conjugated to 5 nm colloidal gold (1:100; G7527; Sigma, USA) or goat anti-rabbit IgG/Gold conjugated to 10 nm colloidal gold (1:100; bs-0295G-Gold; Bioss, Beijing, China) at 37 °C for 1 h. The sections were subjected to three 5 min washes with 0.1 M PB and double distilled water, and subsequently stained with 2% (w/v) uranyl acetate for 5 min, followed by lead citrate for 5 min at 25 °C. The sections were ultimately observed and imaged with a transmission electron microscope (JEM-1400PLUS, JEOL, Japan).

Ultrastructural observations

Leaves were subjected to three 10 min washes with 0.1 M PBS and then fixed at 4 °C in 1% (w/v) osmium tetroxide for 3 h. Following this, the samples were subjected to three 10 min washes with 0.1 M PBS, dehydrated via different concentrations of ethanol, permeabilized and embedded in Epon812 resin (SPI, USA), which was then polymerized at 60 °C. The embedded mass was sliced into semi-thin sections to observe the location, and ultrathin sections were then cut with an ultramicrotome (EM UC7, Leica, Germany), after which they were collected onto formvar-coated Cu grids (Electron Microscopy China, Beijing, China). The sections were stained with 2% (w/v) uranyl acetate for 15 min, followed by lead citrate for an additional 7 min. The sections were then observed and imaged with a transmission electron microscope (TECNAI G2, FEI, USA). The plasmodesma diameters were measured at the neck region via the TEM Imaging & Analysis software (FEI, USA; Schindelin et al., 2012; Liesche et al., 2019).

Validation of DEGs

qRT–PCR assays were performed to validate the expression of interesting DEGs (β-1,3-glucanase and ABA2). The results indicated that the expression trends of both DEGs revealed by qRT–PCR were in accordance with those revealed by RNA-seq (Fig. 1; Supplementary Fig. S1), which suggests that the RNA-seq data reliably reflected the gene expression changes.

Open in a separate window

Fig. 1.

qRT–PCR-based validation of interesting DEGs (ABA2 and β-1,3-glucanase). The mRNA expression of ABA2 (A) and β-1,3-glucanase (B) were detected via qRT–PCR assay. The cycle threshold (CT) values of the target genes were normalized to the CT value of β-actin. (C) β-1,3-glucanase protein was detected by western blot assay. (D) Quantitative results of β-1,3-glucanase protein fragments. Protein relative amounts of β-1,3-glucanase were quantified relative to the expression of Rubisco. Values are means ±SD (n=6). *: P<0.05, **: P<0.01 and ***: P<0.001 versus the control treatment; ^##: P<0.001, versus TMV treatment, as determined by one-way ANOVA.

As shown in Fig. 1A, ABA2 expression significantly decreased (P<0.01) in the TMV treatment compared with that in the control treatment, PDMP reversed the TMV-induced decrease in ABA2 expression in the PDMP/TMV treatment, and no significant difference (P>0.05) in ABA2 expression was found among the PDMP, PDMP/TMV, and control treatments. These results indicated that ABA biosynthesis might be associated with PDMP-induced defence. As shown in Fig. 1B-D, β-1,3-glucanase mRNA and protein expression significantly increased (P<0.001) in the TMV treatment compared with those in the control treatment. Moreover, PDMP decreased β-1,3-glucanase expression in the PDMP/TMV treatment compared with that in the TMV treatment; however, β-1,3-glucanase expression in the PDMP/TMV treatment was still greater compared with the control. β-1,3-glucanase is involved in callose deposition; thus, we speculated that PDMP might induce callose deposition in response to TMV infection. Moreover, the role ABA plays in PDMP-induced callose deposition as a defence response against TMV has not been clarified.

Successful generation of a N. benthamiana ZEP mutant

The ZEP gene encodes an enzyme that plays a catalytic role in the intermediate reaction of the ABA biosynthetic pathway. We first cloned the ZEP gene of N. benthamiana; the nucleic acid and amino acid sequences of NbZEP are shown in Supplementary Fig. S2A. To investigate whether the ABA biosynthetic pathway participates in PDMP-induced callose priming, we generated an N. benthamiana ZEP mutant via Agrobacterium-mediated infection in conjunction with CRISPR/Cas9 gene-editing technology. The target sequence and mutated bases are shown in Supplementary Fig. S2B. In the mutant plants, a single-base insertion of G was detected in the exon of NbZEP. The insertion, which was located at position 74 in NbZEP, produced a premature stop codon (TAA) in the open reading frame (ORF), resulting in a loss-of-function mutation (Supplementary Fig. S2). The mRNA expression of NbZEP in T2 ZEP mutants was measured via a qRT–PCR assay (Fig. 2A), and the ABA concentration in the T2 ZEP mutants was measured via an ELISA (Fig. 2B). As shown in Fig. 2, the expression of NbZEP and the ABA concentration in the mutants were markedly inhibited compared with the wild-type. The results suggested that a N. benthamiana ABA biosynthesis mutant had been generated successfully.

Open in a separate window

Fig. 2.

Validation of CRISPR/gRNA-mediated NbZEP genetic mutants. (A) The expression of ZEP was detected via qRT–PCR assays. The cycle threshold (CT) values of the target genes were normalized to the CT value of β-actin. (B) ABA concentration in the leaves of the NbZEP mutant and wild-type plants was determined by an ELISA. Values are means ±SD (n=20). ***: P<0.001 versus wild-type, as determined by Student’s t test.

Movement of TMV-GFP and callose deposition

To investigate the effects of PDMP on resistance to TMV infection, we observed the movement of GFP-labelled TMV with the naked eye under a handheld UV lamp, and detected callose deposition in N. benthamiana by aniline blue staining and microscopy. As shown in Fig. 3A, GFP fluorescence was detected in the inoculated leaves (7 dpi) and the systemic leaves (13 dpi) of both wild-type and mutant plants in the TMV group and the PDMP/TMV group. Quantitation of the green fluorescence of the inoculated and systemic leaves is shown in Fig. 3B, ​,C,C, respectively. In the wild-type plants, the fluorescence intensity of GFP-labelled TMV in the inoculated and systemic leaves in the PDMP/TMV treatment was markedly reduced compared with that in the TMV treatment alone. In the mutant plants, no difference was found between the TMV and PDMP/TMV treatments. Treatment with exogenous ABA significantly decreased (P<0.001) the fluorescence intensity of TMV in the inoculated and systemic leaves of the mutant plants (Fig. 3B, ​,C).C). These results suggest that PDMP can significantly suppress the speed of TMV movement, and that its inhibitory effect on TMV could be rescued in the mutant by treatment with exogenous ABA.

Open in a separate window

Fig. 3.

Presence of GFP-TMV movement. (A) Movement of TMV is shown by green fluorescence under a UV lamp. Scale bar =1 cm. The green fluorescence in the inoculated leaves (B) and systemic leaves (C) was quantified via ImageJ software. Values are means ±SD (n=6). ***: P<0.001 versus TMV treatment; ^#: P<0.05 and ^###: P<0.001, as determined by one-way ANOVA. ‘m’ indicates ABA biosynthesis mutant.

As shown in Fig. 4A, ​,B,B, callose deposition was observed as turquoise fluorescence after staining with aniline blue and imaged under a fluorescence microscope. These results suggested that PDMP significantly (P<0.001) promoted callose deposition in the wild-type plants inoculated with TMV, whereas little callose deposition was observed in the PDMP/TMV treatment in the mutant. No significant difference (P>0.05) was found between the TMV and PDMP/TMV treatments in the mutant. However, significantly increased (P<0.001) callose deposition was found in the PDMP/TMV treatment of the mutant with ABA compared with the PDMP/TMV treatment of the mutant (Fig. 4A, ​,B).B). In addition, western blotting showed that in the wild-type plants, β-1,3-glucanase protein amounts in the PDMP/TMV treatment were lower than those in the TMV treatment, whereas no significant difference (P>0.05) was found between the TMV treatment and PDMP/TMV treatment in the mutant. However, treatment with ABA decreased the amount of β-1,3-glucanase protein in the mutant plants (Fig. 4C, ​,D).D). Taken together, these results suggested that PDMP-induced callose deposition priming depended on ABA biosynthesis.

Open in a separate window

Fig. 4.

Presence of callose fluorescence and callose-related protein (β-1,3-glucanase). (A) Callose deposition is shown as turquoise fluorescence after staining with aniline blue and imaged under an ultraviolet excitation filter (BP 330–385 nm) via a fluorescence microscope. Scale bar =100 µ m. (B) Relative callose intensities emitted by aniline blue-stained callose deposits (n=6). The turquoise fluorescence was regarded as the regions of interest (ROI). The turquoise fluorescence was chosen and quantified manually using ImageJ software. (C) Western blot validation of β-1,3-glucanase expression. (D) Protein fragments were quantified relative to the expression of Rubisco via ImageJ software (n=3). Values are means ±SD. *: P<0.05 and ***: P<0.001 versus TMV treatment; ^#: P<0.05 and ^###: P<0.001, as determined by one-way ANOVA. ‘m’ indicates ABA biosynthesis mutant.

Immunolocalization of callose

To directly confirm the induction of callose deposition around plasmodesmata by PDMP, β-1,3-glucan and β-1,3-glucanase proteins were detected through immunolocalization experiments. Consistent with the results from the aniline blue staining experiments, compared with the TMV treatment, PDMP/TMV treatment of wild-type plants presented greater amounts of immunogold-labelled β-1,3-glucan and lower amounts of β-1,3-glucanase (Fig. 5A) around the plasmodesmata. However, there was no significant difference (P>0.5) in immunogold-labelled β-1,3-glucan or β-1,3-glucanase between the TMV and the PDMP/TMV treatments in the mutant (Fig. 5A-C). Compared with the TMV-treated wild-type plants, the PDMP/TMV treated wild-type plants presented a greater number of β-1,3-glucan gold particles around the plasmodesmata, but a lower number of β-1,3-glucanase gold particles, whereas no significant difference (P>0.05) in the number of β-1,3-glucan or β-1,3-glucanase gold particles was found between the TMV treatment and the PDMP/TMV treatment in the mutant. However, the addition of ABA increased the number of β-1,3-glucan gold particles and decreased that of β-1,3-glucanase gold particles. Thus, these results indicate that in N. benthamiana, PDMP induces the deposition of callose at plasmodesmata to stimulate resistance to TMV infection through the ABA biosynthetic pathway.

Open in a separate window

Fig. 5.

Analysis of immunocolloidal gold coupled with transmission electron microscopy of callose deposits around plasmodesmata. (A) β -1,3-glucan and β -1,3-glucanase were detected around plasmodesmata in the different treatments. Scale bar =200 nm. Quantitative results of β -1,3-glucan (B) and β -1,3-glucanase (C) gold particles around plasmodesmata. The number of gold particles was counted per individual plasmodesma (8–10 plasmodesmata were analysed per sample). Values are means ± SD (n=3). ***: P<0.001 versus TMV treatment; ^#: P<0.05, ^##: P<0.01 and ^###: P<0.001, as determined by one-way ANOVA. PD: plasmodesma. The red arrows indicate callose particles. ‘m’ indicates ABA biosynthesis mutant.

We are grateful to Weihua Pei (Yunnan Academy of Agricultural Sciences) and Yingqi Guo (Kunming Institute of Zoology, Chinese Academy of Sciences) for their advice and technical assistance with electron microscopy. This study was supported by the Yunnan Fundamental Research Projects (No. 2018FA022) and the National Natural Science Foundation of China (No. 31660038).