Pomegranate Peel Extract as an Inhibitor of SARS-CoV-2 Spike Binding to Human ACE2 Receptor (in vitro): A Promising Source of Novel Antiviral Drugs

High-Resolution Mass Spectrometry Analysis of PPE

Liquid chromatography–mass spectrometry data were acquired on an Accela U-HPLC system coupled to an Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific, San Jose, CA, USA) equipped with a heated electrospray interface. The chromatographic separation was carried out according to Colantuono et al. (2017). Briefly, we used a Gemini C18-110Å column, 150 × 2.0 mm, 5 μm (Phenomenex, Torrance, CA, USA) heated to 30°C and the mobile phases consisted of 0.1% formic acid water (A) and 0.1% formic acid acetonitrile (B) with a flow rate of 200 μL/min. The dry extracts were dissolved in methanol/water (50:50, v/v) and 10 μL were injected into the column. MS data acquisition was performed in negative ionization modes, in the mass range of m/z 100–1,300. The resolving power was set to 50,000 full width at half-maximum (FWHM, m/z 200) resulting in a scan time of 1 s. The automatic gain control was used in balanced mode (1 × 106 ions); maximum injection time was 100 ms. The interface parameters were the following: spray voltage 3,500 kV, capillary voltage 50 V, capillary temperature 275°C, sheath gas 30 arbitrary units, and auxiliary gas 15 arbitrary units.

Calibration curves were constructed in the linearity ranges of 1 to 50 μg/mL for PC and 0.1 to 5 μg/mL for EA and GA. Metabolite identification was performed using exact mass values up to the fifth decimal digit with mass tolerance ±5 ppm. Table 1 reports the polyphenols identified in PPE and individual molecular formula, retention time, theoretical mass, experimental mass, and error. The amount of each compound in the extract was determined using PC, EA, and GA as reference standards for ETs, EA derivatives (EAs), and GA, respectively. Punicalin (α, β isomers), granatin B, Causarinin, Galloyl-HHDP-hexoside, pedunculagin I (bis-HHDP-hex), and pedunculagin II (Digalloyl-HHDP-hex) were expressed as equivalents of PC. EA hexoside, EA pentoside, EA deoxyhexoside were expressed as equivalents of EA. GA was quantified with the correspondent standard. Total polyphenols were calculated as the sum of all the compounds retrieved.

Antioxidant Activity of PPE

The AC of PPE was measured by using the ABTS assay as reported by Re et al. (1999). Briefly, a stable stock solution of ABTS·+ was produced by reacting a 7 mmol/L aqueous solution of ABTS with 2.45 mmol/L potassium persulfate (final concentration) and allowing the mixture to stand in the dark at 4°C for 16 h before use. The ABTS·+ solution was diluted with ethanol to an absorbance of 0.700 ± 0.05 at 734 nm. Freeze-dried PPE was appropriately diluted in water and 0.1 mL of reconstituted extract was added to 1 mL of ABTS·+ solution. The mixture was allowed to stand at room temperature for 2.5 min before the absorbance was recorded at 734 nm by using the multiplate reader Victor Nivo (Perkin Elmer, Woodbridge, ON, Canada). Results were expressed as μmol Trolox equivalents (TE)/g of powder.

SARS-CoV-2 Spike Receptor-Binding Domain (Spike RBD)/ACE2 Binding Inhibitor Assay

The inhibition of the Spike-ACE2 interaction was measured using the SARS-CoV2 Inhibitor Screening Assay kit (Adipogen Corporation, San Diego, CA, USA; Cat. N° AG-44B-0007-KI01). According to the manufacturer's instructions, 100 μL per well of Spike RBD, produced as a recombinant protein in human cells (1 μg/ml), was used to coat a 96-well plate for 16 h at 4°C. The plate was then treated with the blocking buffer (2% albumine bovine serum (BSA) in phosphate buffered saline (PBS)) for 2 h at room temperature, washed in wash buffer (0.1% Tween^® 20 in PBS), and incubated with the PPE or compounds for 1 h at 37°C in the Inhibitor Mix Solution (IMS), composed of 0.2% BSA and 0.05% Tween^® 20 in PBS, containing biotin-conjugated-ACE2 (0.5 μg/mL). ACE2 was prepared as a recombinant protein in human cells. After incubation, HRP labeled-streptavidin diluted (1:200 dilution) was added to each well and incubated for 1 h at room temperature. The reaction was developed by adding 100 μL of tetramethylbenzidine (Neogen, Lansing, MI, USA) for 5 min at RT and measured at 450 nm by the microplate reader Victor Nivo (Perkin Elmer, Woodbridge, ON, Canada).

Microscale Thermophoresis (MST)

MST experiments were performed on a Monolith NT 115 system (Nano Temper Technologies, Munchen, Germany) and designed to evaluate the ability of the PPE to bind ACE2, S protein, and RBD (10108-H08H, 40589-V08B, 40592-V08B from Sino Biological, Wayne, PA, USA). The proteins used in the study were: ACE2 ({"type":"entrez-protein","attrs":{"text":"NP_068576.1","term_id":"11225609","term_text":"NP_068576.1"}}NP_068576.1) (Met1-Ser740), Spike FL ({"type":"entrez-protein","attrs":{"text":"YP_009724390.1","term_id":"1796318598","term_text":"YP_009724390.1"}}YP_009724390.1) (Val16-Pro1296), and RBD Spike ({"type":"entrez-protein","attrs":{"text":"YP_009724390.1","term_id":"1796318598","term_text":"YP_009724390.1"}}YP_009724390.1) (Arg319-Phe541); all three produced as recombinant in baculovirus-insect cells and carrying a polyhistidine tag at the C-terminus. Each protein (10 μM) was labeled with NT-647-NHS reactive dye (30 μM) (NanoTemper Technologies, GmbH, München, Germany), which reacts efficiently with the primary amines of the proteins to form a stable dye protein conjugate. PPE was used in the concentration range of 65–1.92 × 10–3 μM in the experiment with ACE2, 32.5–9.92 × 10–4 μM with Spike and 3.25–9.92 × 10–5 μM with RBD Spike, respectively, preparing 16-point serial dilution (1:2) in PBS supplemented with tween 0.05%. These values corresponded to the quantity of PC, the most abundant extract polyphenol, as determined by chemical analysis. The MST was carried out using 100% LED and 20% IR-laser power at 37°C. The ligand in the experiments with Spike FL and RBD induced quenching of fluorescence and an SDS denaturation test (SD test) was performed to confirm the specificity of the interaction. An equation implemented by the software MO-S002 MO Affinity Analysis (Nano Temper Technologies, Munchen, Germany), provided by the manufacturer was used for fitting the normalized fluorescence values at different concentrations of the ligands (Mercurio et al., 2018; Bellia et al., 2019).

Lentivirus Infection

Human kidney-2 cells (HK-2) were obtained from American Type Culture Collection (ATCC) and were cultured in Dulbecco's modified Eagle medium (DMEM) (EuroClone, Milano Italy) supplemented with 5% (v/v) FBS, 1% insulin-transferrin-sodium selenite media supplement (ITS) (Sigma-Aldrich-Merck KGaA, Darmstadt, Germany) and 1% penicillin-streptomycin. The cells were maintained at 37°C, 5% CO₂ in a humidified incubator according to the guidelines provided by the vendors, plated in 96-well plates (CellCarrier-96 ultra with lid, Perkin Elmer, Woodbridge, ON, Canada), at a density of 5 × 10³ per well in 100 μL culture medium. After 24 h, the cells were incubated with either 0.04 mg/mL of PPE extract or water for 4 h. The cells were then infected with SARS-CoV-2 Spike-pseudotyped lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles, GeneCopoeia, Inc., Rockville, MD, USA) and the control vesicular stomatitis virus G (VSVG) protein pseudotyped lentivirus (HLUC-Lv201 Firefly luciferase + eGFP lentifect, GeneCopoeia, Inc., Rockville, MD, USA) at a concentration of 4.9E + 9 GC/mL and 1.2E + 9 GC/mL, respectively. After 72 h, the cells were fixed in 4% paraformaldehyde and washed three times in PBS. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole, and after washing, the cells were imaged by the Operetta High Content Imaging System (Perkin Elmer, Woodbridge, ON, Canada), using a 20× magnification objective. Acquired images were analyzed by the software Columbus (Perkin Elmer, Woodbridge, ON, Canada), version 2.6.0. Image analysis consisted of identifying and counting viral-infected HK-2 cells based on 488-intensity fluorescence. The infection rate was calculated as the ratio between the number of infected cells and the number of total cells counted per well. The plot shows the percentage of 488-positive cells after pomegranate treatment compared with that in H₂O-treated cells.

Gene Expression Analysis on HK-2 Cells

Cells were plated in 24-well plates at a density of 5 × 10⁴ per well in a 500-μL culture medium. After 24 h the cells were incubated with 0.04 mg/mL of PPE for 72 h and then collected for RNA extraction, performed by the GeneElute Mammalian total RNA purification kit (Sigma Aldrich, Merck KGaA, Darmstadt, Germany). The RNA was treated with deoxyribonuclease (DNAse) I (Thermo Fisher Scientific, Dallas, TX, USA) at 37°C for 30 min. Reverse transcription was performed using the RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Dallas, TX, USA). Semiquantitative RT-PCR was performed with the Quantum RNA™ kit (Thermo Fisher Scientific, Dallas, TX, USA) containing primers to amplify 18S ribosomal RNA (18S rRNA) along with competimers, that reduced the amplified 18S rRNA product within the range to be used as endogenous standard. The amplification reactions were made using specific oligonucleotides by the Mastercycler™ ProS (Eppendorf, Milan, Italy) with the following general scheme: 2 min at 94°C followed by 35 cycles of 94°C for the 30 s, 50°C for 30 s, and 72°C for 30 s, with a 10 min final extension at 72°C. The PCR products were loaded on 1.5% agarose gel, and the amplification bands were visualized and quantified with the Geliance 200 Imaging system (Perkin Elmer, Woodbridge, ON, Canada). The amplification band corresponding to the analyzed gene was normalized to the amplification band corresponding to the 18S and reported as a percentage of untreated controls set as 100%. The used primer sequences for the amplifications were the following: ACE2 Fw ATGTCACTTTCTGCAGCC; ACE2 Rv GTTGAGCAGTGGCCTTACAT; TMPRSS2 Fw ATTGCCGGCACTTGTGTTCA; TMPRSS2 Rv ACAGTGTGCACCTCAAAGAC.

5alpha Reductase Activity

Hair follicle dermal papilla cells (HFDPC) were seeded in a 96-well plate at a density of 8 × 10³, after 16 h they were stimulated with testosterone 600 nM and treated with pomegranate extract or finasteride 100 nM for 24 h. Another 96-well plate was coated with 100 ng of dihydrotestosterone (DHT)-conjugated BSA, the day after the plate was washed with PBS +0.05% Tween20 and incubated with a blocking solution containing PBS, Tween20, and 3% of BSA for 1 h. After three washes, the plate was loaded with 50 μL of cell supernatants derived from cell treatments, plus 50 μL of biotin-conjugated anti-DHT antibody (1:1,000 dilution in PBS + BSA 1%). After 2 h, the plate was washed three times, 5 μg/mL of peroxidase streptavidin conjugated was added to the plate and incubated for 1 h at room temperature. After three washes,0.5 mg/mL of OPD in 50 mM citrate buffer +0.012% H₂O₂ was added and the absorbance was measured at 490 nm by the microplate reader Victor Nivo (Perkin Elmer, Woodbridge, ON, Canada).

3CL Protease Activity Assay

To measure the activity of the viral 3CL protease in the presence of PPE extract we used the Untagged (SARS-CoV-2) Assay kit provided by BPS Bioscience (San Diego, CA, USA), according to the procedure described in the provider's instructions. Briefly, 15 ng of 3CL protease was incubated with the extract at the indicated concentrations or with 500 μM of GC376, used as a positive control. After 30 min of incubation at room temperature, the enzymatic reaction was carried on for 24 h by the addition of 40 μM 3CL protease substrate. The fluorescence was measured by the Victor Nivo Microplate reader (Perkin Elmer Woodbridge, ON, Canada) exciting at 360 nm and detecting at 460 nm.

Effect of PPE on Spike/ACE2 Binding

To assess whether PPE had inhibitory activity on Spike/ACE2 binding, we used a SARS-CoV-2 inhibitor screening kit by Adipogen Corporation (San Diego, CA, USA). PPE, used at three concentrations ranging from 0.04 mg/mL to 1 mg/mL, inhibited the interaction between Spike and ACE2 up to 74%, and this effect was dose-dependent (Figure 1 and Supplementary Figure 1). As a positive control, we used AC384, a monoclonal antibody that inhibited the binding between Spike and ACE2 by specifically recognizing ACE2 itself.

Open in a separate window

Figure 1

Spike/ACE2 binding in the presence of PPE, used at three concentrations, compared with control and antibody inhibitor AC384. The results are the averages of three independent experiments, expressed as percentages respect to control arbitrarily set as 100%. The error bars represent SDs and the asterisks indicate statistically significant values (^*p-value is between 0.01 and 0.05; ^**0.001 and 0.01) according to T-test. ACE2, angiotensin-converting enzyme 2; PPE, pomegranate peel extract.

To provide insights into which of the PPE polyphenols were relevant for that inhibition, the three most abundant components of PPE, that is PC, EA, and GA were individually tested at the same concentrations as present in 0.04 mg/mL PPE. The results in Table 3 and Supplementary Table 1 showed that PC had the most effect on the binding between Spike and ACE2 by exerting 49% inhibition, followed by EA with 36% inhibition, whereas GA did not have any effect.

To further investigate the binding capacity of the pomegranate compounds, the chemical interactions between the extract and Spike, and between the extract and ACE2, were analyzed by MST experiments (Figure 2 and Supplementary Figures 2, 3). The results showed that the PPE bound both the proteins (Figure 2), even though the interaction with Spike was 10-fold as strong as the one with ACE2. Moreover, we supposed that the binding of PPE compounds to Spike was mostly due to a high affinity toward the RBD of the protein, as the binding curve of PPE compounds plus Spike full-length was very similar to that of PPE compounds plus RBD.

Open in a separate window

Figure 2

MST. The binding curves were obtained incubating PPE with the RBD Spike, Spike FL protein, and ACE2. ACE2, angiotensin-converting enzyme 2; MST, microscale thermophoresis; PPE, pomegranate peel extract; RBD Spike, Spike receptor-binding domain; Spike FL, Spike full-length.

The biochemical data prompted us to investigate the capacity of PPE to effectively inhibit the interaction between Spike and ACE2 in a cellular model. To do that, we used a system based on a Spike-carrying Lentivirus, infecting human kidney-2 cells (HK-2), already known to express ACE2 (Koka et al., 2008). As a control, we used a lentivirus that carried the VSVG protein instead of Spike, thus it entered the cells without a specific recognition of any receptor. Both viruses carried the green fluorescent protein (GFP) gene in their RNA genome, which was expressed and easily detected in the cells upon infection. PPE was used at the safe dose of 0.04 mg/mL, as determined by the cytotoxicity MTT assay (data reported in Supplementary Material). As shown in Figure 3, when the cells were infected by the lentivirus carrying the Spike protein in the presence of PPE, the percentage of GFP fluorescent cells (infected cells) was almost significantly abolished after 72 h. In contrast, when the cells were infected by the lentivirus carrying VSVG protein, the percentage of infected cells was reduced only by 18%, suggesting a specific inhibitory effect of PPE toward Spike/ACE2 binding.

Open in a separate window

Figure 3

Infection rate of Spike SARS-CoV-2 pseudo-typed lentivirus in HK-2, determined by GFP fluorescence measure. The results are the averages of six independent experiments, expressed as percentages respect to control arbitrarily set as 100%. The error bars represent SDs and the asterisks indicate statistically significant values (^***p-value is between 0.0001 and 0.001) according to the T-test. GFP, green fluorescent protein; HK-2, human kidney-2 cells (HK-2); SARS-CoV-2, severe acute respiratory syndrome coronavirus-2.

To investigate whether PPE could regulate host genes involved in the virus uptake, we measured the expression level of ACE2 and TMPRSS2 genes in HK-2 cells treated with the extract for 72 h. As reported in Figure 4, the gene expression analysis showed that the treatment of HK-2 cells with the PPE at 0.04 mg/mL reduced the level of ACE2 and TMPRSS2 gene expression by 30 and 70%, respectively. This suggested that PPE, besides Spike/ACE2 binding inhibition, was able to downregulate the expression of two genes responsible for the virus access into the cells.

Open in a separate window

Figure 4

Gene expression analysis in HK-2 cells treated with PPE for 72 h. The results are the averages of three independent RT-PCR experiments. The values are expressed as percentages respect to control arbitrarily set as 100%. The error bars represent standard deviations and the asterisks indicate statistically significant values (^**p-value is between 0.001 and 0.01; ^***0.0001 and 0.001) according to T-test. HK-2, human kidney-2 cells (HK-2); PPE, pomegranate peel extract; RT-PCR, real-time reverse transcription polymerase chain reaction.

As the expression of TMPRSS2 was mainly regulated by androgens (Hong et al., 2008; Oyelowo et al., 2019), we analyzed whether PPE inhibited the 5α-reductase activity, the primary enzyme involved in DHT synthesis. As shown in Figure 5, PPE at 0.04mg/mL reduced the activity of the 5α-reductase by 65% in HFDPC, after stimulation by testosterone. This effect was similar to that obtained by finasteride, used as a positive control (Rattanachitthawat et al., 2019).

Open in a separate window

Figure 5

5α-Reductase activity in HFDPC stimulated with testosterone 600 nM and treated with either PPE or finasteride 100 nM. The results are the averages of three independent experiments, expressed as percentages respect to testosterone stimulated cells, arbitrarily set as 100%. The error bars represent SDs and the asterisks indicate statistically significant values (^**p-value is between 0.001 and 0.01) according to T-test. HFDPC, human follicle dermal papilla cells; PPE, pomegranate peel extract.