Lentiviral Vector-Based Prime/Boost Vaccination against AIDS: Pilot Study Shows Protection against Simian Immunodeficiency Virus SIVmac251 Challenge in Macaques ^▿

Innate cytokines.

The presence of alpha interferon (IFN-α; PBL Biomedical Laboratories), interleukin-6 (IL-6; U-Cytech Bioscience), and tumor necrosis factor alpha (TNF-α; U-Cytech Bioscience) in the plasma shortly after subcutaneous injection was measured by ELISA according to the manufacturer's instructions.

IFN-γ ELISPOT.

Enzyme-linked immunospot (ELISPOT) assays were performed using MSIP plates (Millipore), the anti-IFN-γ monoclonal antibody GZ-4, and the biotin-conjugated anti-IFN-γ monoclonal antibody 7-B6-1 (Mabtech), streptavidin-alkaline phosphatase and the BCIP (5-bromo-4-chloro-3-indolylphosphate)-nitroblue tetrazolium substrate solution. Spots were numerated by using a Bioreader 4000 (Biosys). Briefly, 0.2 × 10⁶ peripheral blood mononuclear cells (PBMC) per well were restimulated in vitro for 40 h with 11 pools of 5 to 12 overlapping 15-mer peptides (2 μg of each peptide/ml; SIVmac239 GAG [15-mer] Peptides-Complete Set; AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH) or with Aldrithiol AT-2-inactivated SIVmac239 (5 μg of total protein/ml) or its control microvesicles (NIBSC, Potters Bar, United Kingdom). The mean number of IFN-γ spot-forming cells (SFC) per million PBMC was calculated from triplicate wells after subtracting the one from control wells (medium without peptide). A pool specific response was considered positive when superior to 200 IFN-γ SFC/million PBMC (three times the median background measured before priming). The cumulative responses shown correspond to the sum of IFN-γ SFC/million PBMC obtained with each pools of peptides. It should be noted that in these settings, SFC may included not only short-lived effector CD4⁺ and CD8⁺ T cells but also memory T cells.

Plasma viral loads.

Viral RNA was isolated from plasma (200 μl) with TRI Reagent BD (Molecular Research Center). The number of RNA copies was determined in a quantitative one-step reverse transcription-PCR (RT-PCR) using TaqMan EZ RT-PCR (Applied Biosystems) and Mastercycler ep realplex (Eppendorf International). The primers were, respectively, at positions 389 and 456 of the SIVmac251 GAG mRNA genome (forward, TGTCCACCTGCCATTAAGCCCGA; reverse, GCAGAGGAGGAAATTACCCAGTAC). The TaqMan quantification method was chosen with an internal probe containing the FAM and TAMRA fluorophores, respectively, at the 5′ and 3′ ends (TGTCCACCTGCCATTAAGCCCGA). The quantity of viral RNA copies was assessed by extrapolation of the threshold fluorescence values onto an internal standard curve prepared from serial dilutions in distilled H₂O of RNA obtained by in vitro transcription with the MAXIscript kit (Ambion) of an SpeI-linearized pGEM-5Zf(+) GAG plasmid. The threshold of detection was 375 viral RNA copies/ml (2.57 log₁₀ RNA copies/ml).

CD4⁺ T-cell counts.

Quantifications of the absolute lymphocyte counts and the proportions of total CD3⁺ CD4⁺ CD8⁻ T cells and CD28⁺ CD95⁺ memory CD4⁺ T cells were described previously (28).

MHC microsatellite haplotype analysis.

Genomic DNA were extracted from whole blood collected on EDTA tubes (QIAamp DNA blood; Qiagen). Major histocompatibility complex (MHC) microsatellite haplotype analysis were performed by A. Aarnink and A. Blancher (Laboratoire d'Immunogénétique Moléculaire, Hôpital Rangueil, Toulouse, France) using 20 microsatellite markers spanning the MHC region as described previously and defining seven common haplotypes in Mauritian cynomolgus macaques (19, 57).

Induction of strong immune responses after a single injection.

First, it was found that subcutaneous administration of lentiviral particles induced a very mild and transient systemic inflammation, based on IFN-α, IL-6, and TNF-α measured in plasma early after injection (Fig. ​(Fig.2).2). Second, a single injection of low doses of lentiviral vector was sufficient to induce robust cellular immunity, regardless of the dose received (from 2.5 × 10⁷ to 2.5 × 10⁸ TU/animal) (Fig. ​(Fig.3A).3A). SIVmac239 GAG-specific T-cell responses peaked at 16 days after priming (postprime), reaching a high frequency of IFN-γ-secreting cells (up to 3,000 IFN-γ SFC/million PBMC), and returned to preimmunization levels 2 months after immunization. For some macaques (animals 20056 and 20158), the frequency of specific T cells at the peak of primary responses was so high that spots overlapped, making it impossible to enumerate them precisely. In these cases, the number of IFN-γ SFC/million was largely underestimated, and saturated responses are indicated by the symbol “+” (Fig. ​(Fig.33).

Open in a separate window

FIG. 2.

Subcutaneous injection of lentiviral vector did not result in systemic inflammation. The presence of IFN-α (A), IL-6 (B), and TNF-α (C) in the plasma shortly after subcutaneous injection was measured by ELISA (white, before injection; dots, 1 h after; strips, 6 h after; gray, 1 day after; black, 1 week after). The absence of either significant (IFN-α and TNF-α) or major (IL-6) increases in their level suggested that there was not systemic inflammation induced by the in vivo administration of lentiviral vector particles, even at a high dose (2.5 × 10⁸ TU/animal). These data did not exclude a local inflammation likely triggered by intrinsic pathogen-associated molecular pattern (PAMP) (7, 20, 43).

Open in a separate window

FIG. 3.

A prime/boost lentiviral vector-based vaccination strategy induces robust cellular immunity. The longitudinal follow-up of the SIVmac239 GAG specific T-cell responses was performed at various time points postprime (light gray), postboost (medium gray), and postchallenge (dark gray) by IFN-γ ELISPOT assay after restimulation of whole PBMC with pools of overlapping peptides encompassing SIVmac239 GAG p55. The individual GAG-specific cumulative responses of all six vaccinated animals injected with TRIP-SIVmac239 GAG (low dose, animals 20022 and 20089; medium dose, animals 20293 and 20056; and high dose, animals 20195 and 20158) (A), two control animals immunized with an irrelevant antigen (TRIP-GFP) at a high p24 dose (animals 21544 and 20456) (B), and unvaccinated animals (animals 15661, 14184, 15885, and 14468) (C) are shown. Arrows indicate when the first injection (three doses), the second injection (identical dose), and the SIVmac251 challenge were performed. Aldrithiol AT-2 inactivated SIVmac239 was also used to restimulate GAG-specific CD4⁺ and CD8⁺ T cells 2 weeks postboost in a whole PBMC IFN-γ ELISPOT assay. Background after coculture with the control microvesicles was subtracted (D). When the frequency of specific T cells was high and spots overlapped, the number of IFN-γ SFC/million was underestimated to 1,400 before the background was subtracted. Indeed, the saturation curve of the ELISPOT reader was calculated by using serial dilutions of PBMC, and the maximum number of spots enumerated per well appeared to be 280 spots, corresponding to 1,400 spots/million PBMC when 200,000 cells were cultured. The symbol “+” was added at the top of the histogram when saturation was reached for at least one pool of peptides. At 2 weeks postchallenge, it was not possible to quantify the number of spots in the control medium without peptide wells and thus to calculate the cumulative response for animal 20022 (noted as “++”). nd, Not determined.

The cellular responses were SIV GAG specific, resulting from the presentation of peptides derived from SIV GAG encoded by the transferred gene rather than from the presentation and cross-presentation of peptides derived from HIV-1 GAG present in the vector particles (since SIV and HIV-1 GAG share sequence similarities), as shown by the low reactivity observed in the two GFP control animals (Fig. ​(Fig.3B)3B) compared to the reactivity observed in the vaccinees (Fig. ​(Fig.3A3A).

In addition to the robustness of primary responses, these were also found to be multispecific, reacting with an average of three pools of peptides out of eleven (from one for macaque 20089 to six for macaque 20195) (Table ​(Table2,2, section 1, far-right column). In our outbred cohort, we observed that the SIVmac239 GAG specific IFN-γ responses were preferentially directed against two pools within the C-terminal region of GAG covering a part of p27 CA and p9 NC. All six vaccinees mounted a vigorous response against the pool covering SIVmac239 GAG:337-395, and five of six mounted a vigorous response against the pool covering SIVmac239 GAG:385-443 (Table ​(Table2,2, section 1, bottom row). Such concordant immune responses may reflect the simple MHC genetics and the extensive sharing of MHC haplotypes, which characterize Mauritian cynomolgus macaques (57). These two pools of peptides actually contain the GAG GW9 peptide recently described as an immunodominant epitope restricted by Mafa-A*25 and Mafa-A*29, two MHC class IA alleles expressed by 88% of the Mauritian cynomolgus macaques (11).

Animals also developed neutralizing humoral responses against VSV-G serotype Indiana that were dose dependent (Fig. ​(Fig.4A).4A). However, importantly, sera from vaccinated animals did not neutralize vectors pseudotyped with VSV-G New Jersey in vitro (Fig. ​(Fig.4B).4B). These results were in agreement with studies using VSV as a vector (46) or VSV-G-pseudotyped single-cycle SIV (26).

Open in a separate window

FIG. 4.

Injected animals develop humoral responses to VSV-G used to pseudotype the vector particles. The presence of neutralizing antibody against the envelope used for pseudotyping was measured with an in vitro transduction assay. P4 cells (HeLa derived) were cultured in the presence of lentiviral vectors encoding GFP-pseudotyped with VSV-G Indiana (A) or VSV-G New Jersey (B) preincubated with plasma diluted at 1:20 from immunized animals collected at various time points (black, before priming; gray, 2 weeks postprime; dots, 8 weeks postprime; and white, 2 weeks postboost). The transduction efficacy was assessed by flow cytometry. In the absence of plasma and at the dose of vector used, 61 and 23% of P4 cells were GFP⁺ after transduction with lentiviral vectors encoding GFP pseudotyped with VSV-G Indiana and New Jersey, respectively.

Boost effect of a second injection with lentiviral particles pseudotyped with a non-cross-reactive VSV-G envelope.

Since no clear dose response after the prime injection was observed, we decided to boost the animals using an intermediate quantity (1.2 × 10⁸ TU/animal) of TRIP-SIVmac239 GAG particles pseudotyped with VSV-G New Jersey at 11 weeks postprime. This delay between the prime and boost was dictated by the expansion-contraction phases of the vaccine-induced primary T cells responses, assessed by IFN-γ ELISPOT assay.

SIVmac239 GAG-specific T-cell responses were efficiently restimulated by the second injection (Fig. ​(Fig.3A).3A). The magnitude of responses was increased, with kinetics typical of secondary responses, that is, faster onset and longer persistence. IFN-γ-secreting cells were detected as early as 1 week after the second immunization and at up to 2 months and more. The breadth of the cellular responses was not improved (Table ​(Table2,2, section 2). To mimic more closely the processing and trafficking steps that occur in infected cells for antigen presentation but which are bypassed by peptide pulsing, AT-2-inactivated SIVmac239 was also used as antigen. Weak (macaque 20089) to strong (≥500 IFN-γ SFC/million PBMC for macaques 20022, 20195, and 20056) responses were observed (Fig. ​(Fig.3D3D).

Given the robust and broad cellular immune responses induced by the vaccine, we tested its protective efficacy against SIV infection. Macaques were challenged 11 weeks postboost by intrarectal inoculation of a massive dose of SIVmac251 (500 50% animal infective doses [500 AID₅₀]), 10- to 25-fold more virus than typically used (Table ​(Table11 and Fig. ​Fig.1).1). Strong anamnestic SIV GAG specific responses were observed in the peripheral blood of immunized animals shortly after challenge (within a week) in contrast to unvaccinated and GFP control animals. These responses peaked earlier and more vigorously (more than 4,000 SIV GAG specific IFN-γ SFC/million PBMC) (Fig. 3A to C). An earlier and higher rebound of total, CD28⁺ CD95⁻ naive, and CD28⁺ CD95⁺ memory CD8⁺ T cells was also documented during primary infection in vaccinated animals compared to unvaccinated and TRIP-GFP injected control animals (data not shown). GAG regions mapped after immunizations were recalled by the challenge, and new immunogenic regions were also detected after infection (Table ​(Table2,2, section 3). The diversity of the GAG-specific responses was comparable for vaccinated and unvaccinated or GFP control animals, however (Table ​(Table2,2, section 3).

Protection against a SIVmac251 challenge.

Although viral challenge led to infection in all animals (Fig. 5A and B), immunization conferred protection against viral replication and depletion of the CD28⁺ CD95⁺ memory CD4⁺ T cells during the acute phase. TRIP-GFP-injected control animals showed a course of infection very comparable to that of unvaccinated macaques and were therefore gathered as a single group (Fig. ​(Fig.5A).5A). In the plasma of these naive and GFP control animals, the peak of viral replication was high with a geometric mean of 3.19 × 10⁶ viral RNA copies/ml. Viral loads then decreased in all six unvaccinated and GFP control animals to reach low to moderate set-point plasma viral RNA levels (days 70 to 154) with a geometric mean of 4.65 × 10⁴ viral RNA copies/ml (Fig. ​(Fig.5A).5A). In contrast, viremia at the peak of acute infection of all six immunized animals were lower than in naive and GFP control animals by at least 2 orders of magnitude with a geometric mean of 1.52 × 10⁴ viral RNA copies/ml (Fig. 5B and C). From the six vaccinated macaques, four suppressed peak viremia by more than 2 log₁₀ fold (macaques 20022, 20293, 20158, and 20195), two suppressed peak viremia by more than 3 log₁₀ fold (macaques 20293 and 20158), and one suppressed peak viremia by more than 4 log₁₀ fold (macaque 20195) (Fig. ​(Fig.5E).5E). After resolution of the peak viremia, the viral loads decreased (Fig. ​(Fig.5B)5B) and remained persistently below those of unvaccinated and control animals, but these differences were not statistically significant by day 49 postinfection (Fig. ​(Fig.5C).5C). However, when the cumulative replications during the first 154 days of infection (expressed as the area under the curve of viral load as a function of time) were compared, the benefit provided by vaccination was statistically significant (data not shown).

Open in a separate window

FIG. 5.

Vaccinated macaques have an improved control of viremia compared to unvaccinated and GFP control animals. Plasma viral loads were monitored for 5 months postchallenge, twice a week during the first 3 weeks, then once a week during the next 3 weeks and finally once a month. Viremia of unvaccinated (panel A in blue), GFP control (panel A in green), and vaccinated animals (panel B in red), as well as the geometric mean for the naive and GFP control group (in black) versus the vaccinated group (in gray) (A to C) are shown. The geometric mean of viral replication levels was lower in the vaccinated group at all time points tested (C). An average 2 log₁₀ fold reduction of viremia was observed at the peak of acute infection (E). The geometric mean viremia of the vaccinated animals (in gray) was also compared to that of progressor animals (14184, 21544, and 20456) in orange and of slow progressor animals (15661, 15885, and 14468) in light blue (D). Post-acute-phase viremia levels were lower in vaccinated animals than in progressor animals. *, P < 0.05.

We also monitored the evolution of CD4⁺ T cells in the peripheral blood during the course of infection, and more particularly the subset of CD28⁺ CD95⁺ memory CD4⁺ T cells, because their depletion correlates with plasma viral loads (28) and their preservation during acute and chronic SIV infection predicts long-term survival of vaccinated monkeys better than set-point viral load levels (30, 34). During acute infection, there was a rapid and profound decline of the CD28⁺ CD95⁺ CD4⁺ T cells in the peripheral blood of the unvaccinated and GFP control animals (Fig. ​(Fig.6A).6A). CD28⁺ CD95⁺ CD4⁺ T-cell counts remained low with signs of gradual depletion for half of them (macaques 21544, 14184, and 20456), whereas depletion was transient and followed by a return to baseline for the other half (macaques 15661, 15885, and 14468). These two subgroups further demonstrated moderate and low post-acute-phase viremia correspondingly (Fig. ​(Fig.5A)5A) and were therefore classified as progressor (macaques 14184, 21544, and 20456) and slow progressor control animals (macaques 15661, 15885, and 14468) (Fig. ​(Fig.5D5D and ​and6D).6D). Vaccinated animals showed full preservation or only low depletion of their CD28⁺ CD95⁺ CD4⁺ T cells during peak viremia, and all of them rapidly recovered their CD28⁺ CD95⁺ CD4⁺ T lymphocytes, except macaque 20089 (Fig. ​(Fig.6B).6B). Thus, the vaccine conferred protection against the severe depletion of the CD28⁺ CD95⁺ memory CD4⁺ T-cell compartment (Fig. 6C and E). This preservation also applied to total CD4⁺ T cells (Fig. ​(Fig.6F).6F). Importantly, viremia of vaccinated animals at late time points was reduced by around a 1 log₁₀ fold factor compared to progressor control animals (Fig. ​(Fig.5D),5D), whereas post-acute-phase viremia and CD28⁺ CD95⁺ CD4⁺ T-cell counts were strikingly similar between vaccinees and slow progressor control animals (Fig. ​(Fig.6D6D).

Open in a separate window

FIG. 6.

The total and CD28⁺ CD95⁺ memory CD4⁺ T-cell compartments are well preserved in vaccinated macaques. Changes in the numbers of CD28⁺ CD95⁺ memory CD4⁺ T cells in the peripheral blood were monitored for 5 months postchallenge. The percentages of baseline CD28⁺ CD95⁺ CD4⁺ T cells of unvaccinated (panel A in blue), GFP control (panel A in green), and vaccinated animals (panel B in red), as well as the mean for the naive and GFP control group (in black) versus the vaccinated group (in gray) (A to C), are shown. Vaccinated animals showed a full preservation of their CD28⁺ CD95⁺ CD4⁺ T-cell compartment during acute infection in contrast to naive and GFP control animals (C) and no gradual depletion in the chronic phase in contrast to progressor animals (14184, 21544, and 20456) in orange (D). *, P < 0.05. CD28⁺ CD95⁺ memory CD4⁺ T cells for all animals are compared at the peak of acute infection (E). The dynamics of total CD4⁺ T cells in vaccinees (in gray) also differ from those of control animals (in black) (F). *, P < 0.05.

The SIVmac239 GAG (15-mers) Peptides-Complete set was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. AT-2-inactivated SIVmac239 and its control microvesicles were obtained from J. D. Lifson (Frederick, MA) through the EU Program EVA Centralized Facility for AIDS Reagents (NIBSC, Potters Bar, United Kingdom). We acknowledge J. K. Rose for the gift of pBS-NJG; A. Aarnink and A. Blancher for the MHC haplotype analysis; N. J. Arhel for critical reading of the manuscript; and R. Le Grand, F. Martinon, B. Delache, S. Beq, N. Chanciner, and E. Birlouez for their expertise in the follow-up of our primate cohort.

This study was supported by the ANRS, SIDACTION, the Institut Pasteur, and the CNRS.

P.C. is a founder of TheraVectys, and K.M. is an employee of and shareholder in TheraVectys, a company whose goal is the development of an AIDS therapeutic vaccine.