Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1999 Mar 2;96(5):2285-90.
doi: 10.1073/pnas.96.5.2285.

Activation of target-tissue immune-recognition molecules by double-stranded polynucleotides

K Suzuki  1 , A Mori, K J Ishii, J Saito, D S Singer, D M Klinman, P R Krause, L D Kohn
Affiliations

Activation of target-tissue immune-recognition molecules by double-stranded polynucleotides

K Suzuki et al. Proc Natl Acad Sci U S A. .

Abstract

Abnormal expression of major histocompatibility complex (MHC) class I and class II in various tissues is associated with autoimmune disease. Autoimmune responses can be triggered by viral infections or tissue injuries. We show that the ability of a virus or a tissue injury to increase MHC gene expression is duplicated by any fragment of double-stranded (ds) DNA or dsRNA introduced into the cytoplasm of nonimmune cells. Activation is sequence-independent, is induced by ds polynucleotides as small as 25 bp in length, and is not duplicated by single-stranded polynucleotides. In addition to causing abnormal MHC expression, the ds nucleic acids increase the expression of genes necessary for antigen processing and presentation: proteasome proteins (e.g., LMP2), transporters of antigen peptides; invariant chain, HLA-DM, and the costimulatory molecule B7.1. The mechanism is different from and additive to that of gamma-interferon (gammaIFN), i.e., ds polynucleotides increase class I much more than class II, whereas gammaIFN increases class II more than class I. The ds nucleic acids also induce or activate Stat1, Stat3, mitogen-activated protein kinase, NF-kappaB, the class II transactivator, RFX5, and the IFN regulatory factor 1 differently from gammaIFN. CpG residues are not responsible for this effect, and the action of the ds polynucleotides could be shown in a variety of cell types in addition to thyrocytes. We suggest that this phenomenon is a plausible mechanism that might explain how viral infection of tissues or tissue injury triggers autoimmune disease; it is potentially relevant to host immune responses induced during gene therapy.

PubMed Disclaimer

Figures

Figure 1
Figure 1
DNA induces MHC expression in cells. FRTL-5 cells (2 × 106 cells in 10-cm dishes) were infected with HSV (a, lanes 1–4; ref, 29), or, alternatively, they were transfected with 5 μg of HSV DNA fragments (a, lane 7), the indicated DNAs (b, lanes 3–7), RNA (b, lanes 8 and 9), or the following 54-bp ds oligodeoxynucleotides (ODNs) from Foamy virus or cytomegalovirus (CMV; b, lanes 10 and 11): CATCTTCCAGTTCATCTCTAGTCATTTGGGCTGTTTCGGCCATTGTTACTGGTC and CTATTTGCACCACGTTCGCAGCCATACCAATCTACCTGATCCCATCTCCAGGCT, respectively. GAPDH = glyceraldehyde-3-phosphate dehydrogenase. (c) Fluorescence-activated cell sorter analysis of cell-surface MHC class I and class II expression induced by DNA or 100 units/ml rat γIFN 48 h after treatment. Cells were transfected with 5 μg of pcDNA3 (Invitrogen), exactly as they were for all dsDNAs in a and b. The dashed line represents control staining with fluorescein isothiocyanate-labeled normal mouse IgG1. The data shown in a, b, and c are typical results from three experiments performed on different batches of cells. (d and e) Cells were transfected with the indicated amounts of dsDNA (d, lanes 3–6), treated with γIFN (d, lanes 7–10), or exposed to both (d, lane 11). d depicts Northern blotting from one representative experiment; e presents the mean ± SD from four separate experiments expressed relative to the maximum induction of class I RNA (Left) or the maximum induction of class II RNA by γIFN (Right). (a–e) The total RNA was prepared, and Northern analysis was performed at the times noted or 48 h after treatment. Lipofectamine treatment alone served as a control transfection procedure (Mock).
Figure 2
Figure 2
Properties of the nucleic acid needed to induce MHC expression in cells. Transfection and Northern analysis were performed exactly as described for Fig. 1. (a) FRTL-5 cells were transfected with intact, methylated, or DNase-treated plasmids, pcDNA3 or pRc/RSV (lanes 3–8), ss CpG ODNs or control ODNs (lanes 9–12), or ss or ds phosphorothioate oligonucleotides (s-oligos; lanes 13–16). Lane 1 contains RNA from nontreated cells, and lane 2 contains only RNA from cells subjected to the transfection procedure. ODN-1 is the Foamy virus oligonucleotide. ODN-2 is the cytomegalovirus oligonucleotide. CpG-1 is GCTAGACGTTAGCGT; non CpG-1 is GCTAGATGTTAGCGT; CpG-2 is TCAACGTTGA; and non CpG-2 is TCAAGCTTGA. (b) Various synthetic polynucleotides and their duplexes were transfected similarly and analyzed (lanes 3–16). (c) Cells were transfected with 5 μg of dsDNA fragments from 24 bp to 1,004 bp in length (lanes 3–10) or with the indicated amount of 25-bp dsODNs (lanes 12–15). MHC class II expression was measured 48 h later by reverse transcription–PCR (15, 16). Cells treated with 100 units/ml γIFN for 48 h were the positive control. These results are typical of at least five different experiments performed on different batches of cells.
Figure 3
Figure 3
Effect of ds nucleic acids on genes required for antigen processing and presentation by MHC genes. Transfection, IFN treatment, and Northern analysis were performed 3–72 h after treatment as described for Figs. 1 and 2. Transfection was with 5 μg of poly(dI-dC)⋅poly(dI-dC) (dsDNA) or poly(I-C)⋅poly(I-C) (dsRNA). These are typical results from at least four different experiments on different batches of cells.
Figure 4
Figure 4
dsDNA activates Stat1, Stat3, MAPK, and NF-κB. dsDNA transfection and IFN treatment of FRTL-5 cells were performed exactly as described for Figs. 1–3 by using 5 μg of poly(dI-dC)⋅poly(dI-dC). (a) Total cell lysate was prepared, and Western blot analysis was performed as described (20). Lane 1 (P.C.) contains a positive control cell lysate (New England Biolabs). (b) Nuclear protein was prepared, and gel-shift analysis was performed as described (15, 16, 19). Consensus ODNs for Stat3 and NF-κB are from Santa Cruz Biotechnology. (c) Western blot analysis with an antibody against phosphorylation-specific p44/p42 MAPK. Shown are typical results from at least four different experiments performed on different batches of cells.
Figure 5
Figure 5
Tissue damage by electric pulsing coordinately increases MHC gene expression and genomic DNA in the cytoplasm. FRTL-5 cells (5 × 106 cells in Dulbecco’s PBS) were pulsed once with a Gene Pulser (Bio-Rad) set at 0.3 kV and at capacitances of 0.25, 25, 125, 250, and 960 μF or pulsed twice with a capacitance of 960 μF (lanes 3–8, respectively). Cells were washed with medium, returned to a 10-cm dish, and cultured for 48 h until RNA was recovered. Damage was estimated microscopically by trypan-blue exclusion and plating efficiency after pulsing. After two pulses at 960 μF, 60% of cells were fused or died. (a) Reverse transcription–PCR data compare MHC class II expression with contamination of total RNA preparations by leaked genomic DNA, measured by using PCR primers that detect an intron sequence of rat CIITA genome DNA (M. Pietrarelli, K.S., and L.D.K., unpublished results). Data are typical results from four different experiments performed on different batches of cells. (b) The correlation of MHC class II and CIITA intron levels for pulses eliciting significant increases of each (as shown in a, lanes 5–8) is presented after densitometry of the results. Data are mean values from four experiments.
See this image and copyright information in PMC

Similar articles

See all similar articles

Cited by

See all "Cited by" articles

References

    1. Bottazzo G F, Pujol-Borrell R, Hanafusa T, Feldmann M. Lancet. 1983;ii:1115–1119. - PubMed
    1. Todd I, Londei M, Pujol-Borrell R, Mirakian R, Feldmann M, Bottazzo G F. Ann N Y Acad Sci. 1986;475:241–249. - PubMed
    1. Guardiola J, Maffei A. Crit Rev Immunol. 1993;13:247–268. - PubMed
    1. Singer D S, Mozes E, Kirshner S, Kohn L D. Crit Rev Immunol. 1997;17:463–468. - PubMed
    1. Londei M, Lamb J R, Bottazzo G F, Feldmann M. Nature (London) 1984;312:639–641. - PubMed

MeSH terms

LinkOut - more resources

-