RH94493 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH94493

Symbol: RH94493
Previously known as: L16922; 
RGD ID: 5032133
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.286,131,303 - 6,131,491 (+)MAPPERmRatBN7.2Rnor_6.087,187,548 - 7,187,735NCBIRnor6.0Rnor_5.087,172,513 - 7,172,700UniSTSRnor5.0RGSC_v3.485,845,653 - 5,845,840UniSTSRGSC3.4Celera87,667,799 - 7,667,986UniSTSCytogenetic Map8q11UniSTS
Is Marker For: Genes:   Pgr  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTGTGGTGTGTCATTTTGTCT
Reverse Primer AAACTCTCAAAATATGGGTGCAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3317Pgrprogesterone receptor860726736131552Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590084Insglur5Insulin/glucose ratio QTL 518.540.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)8124597739Rat
2317882Alcrsp24Alcohol response QTL 243.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)8125902202Rat
12880023Bw184Body weight QTL 1840.001body mass (VT:0001259)body weight (CMO:0000012)8209764047097640Rat
12880025Cm102Cardiac mass QTL 1020.044heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)8209764047097640Rat
12880028Cm103Cardiac mass QTL 1030.02heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)8209764047097640Rat
12880044Am9Aortic mass QTL 90.007aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)8209764047097640Rat
2317032Ginf2Gastrointestinal inflammation QTL 23.210.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)8470581049705810Rat
2317036Livw3Liver weight QTL 32.430.01liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)8470581049705810Rat
2317048Ginf1Gastrointestinal inflammation QTL 13.520.005cecum mucosa thickness (VT:0010234)enterocolitis severity score (CMO:0002138)8470581049705810Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 25154 UniSTS
UniSTS 119741 UniSTS





-