Skip to main content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Dev Cell. Author manuscript; available in PMC 2008 Jun 1.
Published in final edited form as:
Dev Cell. 2007 Jun; 12(6): 851–862.
doi: 10.1016/j.devcel.2007.03.022
PMCID: PMC1945814
NIHMSID: NIHMS25278
PMID: 17543859

zucchini and squash encode two putative nucleases required for rasiRNA production in the Drosophila germline

Attilio Pane, Kristina Wehr, and Trudi Schüpbach*
Author information Copyright and License information PMC Disclaimer

Abstract

RNAi is a widespread mechanism by which organisms regulate gene expression and defend their genomes against viruses and transposable elements. Here we report the identification of Drosophila zucchini (zuc) and squash (squ), which function in germline RNAi processes. Zuc and Squ contain domains with homologies to nucleases. Mutant females are sterile and show dorsoventral patterning defects during oogenesis. In addition, Oskar protein is ectopically expressed in early oocytes, where it is normally silenced by RNAi mechanisms. Zuc and Squ localize to the perinuclear nuage and interact with Aubergine, a PIWI class protein. Mutations in zuc and squ induce the upregulation of Het-A and Tart, two telomere-specific transposable elements, and the expression of Stellate protein in the Drosophila germline. We show that these defects are due to the inability of zuc and squ mutants to produce repeat-associated small interfering RNAs.

Introduction

In eukaryotic organisms, RNAi or “RNA interference” controls a wide variety of biological processes, including development, genome organization, viruses and transposable elements defense (Brennecke et al., 2003; Meister and Tuschl, 2004; Savitsky et al., 2006; Wang et al., 2006; Zambon et al., 2006). RNAi is triggered by small RNA molecules, which can be grouped in three classes: siRNAs, micro-RNAs (miRNAs) and repeat-associated small interfering RNAs (rasiRNAs) (Meister and Tuschl, 2004). In Drosophila, Dcr2 is responsible for the maturation of the siRNAs from long dsRNA (Lee et al., 2004), while the Dcr1/Loquacious complex produces miRNAs from hairpin structures (Saito et al., 2005). siRNAs and miRNAs are then incorporated into specific RNP complexes, which are named respectively RISC (RNA Induced Silencing Complex) and miRNP. Core components of the RISC and miRNP complexes are members of the Argonaute (Ago) family, like Ago1 and Ago2. While RISC has been shown to target the transcripts for destruction, the miRNP complex is implicated in the control of mRNA translation. The third class of small RNAs, the so called rasiRNAs, shares sequence complementarity with mobile elements, satellite and micro-satellite DNA and tandem repeats (Aravin et al., 2003). It has recently been reported that the biogenesis of the rasiRNAs does not proceed through Dcr1 and Dcr2, thus pointing to a novel mechanism for the maturation of these molecules (Vagin et al., 2006). rasiRNAs are thought to assemble into RNP complexes containing members of the PIWI family, such as Piwi and Aubergine (Aub), which are involved in chromatin organization as well as in triggering target mRNA destruction to protect the fly genome from selfish genetic elements (Saito et al., 2006).

RNAi has been recently shown to be involved in axial polarization in the Drosophila germline (Cook et al., 2004; Tomari et al., 2004). In this species, establishment of dorsal-ventral (DV) and anterior-posterior (AP) axes is achieved through the localized translation of specific mRNAs. The protein products of gurken (grk) and oskar (osk) genes are essential for this process (Ephrussi and Lehmann, 1992; Huynh and St Johnston, 2004; Neuman-Silberberg and Schupbach, 1993). Early during oogenesis, grk RNA encoding a TGFα-like molecule, is localized to the posterior of the oocyte, where it signals the posterior fate to the adjacent follicle cells. Following the reorganization of the microtubule cytoskeleton at stage 8, the oocyte nucleus and grk RNA are relocalized to the dorsal-anterior corner of the oocyte. Grk protein now induces dorsal cell fates in the surrounding epithelial cells. In contrast to Grk, which is expressed throughout oogenesis, osk mRNA is kept silenced early during oocyte development. At later stages, Osk protein is found at the posterior of the oocytes where it directs the organization of the germ plasm as well as abdomen formation of the future embryo. The silencing of oskar translation from stage 1 to 6 is controlled by a set of genes, including armitage (armi), maelstrom (mael), spindle-E (spn-E) and aubergine (aub), which have been shown to be required for RNAi phenomena (Cook et al., 2004). Mutations in these genes induce ectopic expression of Osk at early stages of oocyte development. This observation revealed a connection between the RNAi machinery and the establishment of the AP axis during Drosophila oogenesis. armi encodes the homologue of Arabidopsis SDE-3 helicase (Cook et al., 2004), which plays a role in Post Transcriptional Gene Silencing (PTGS), a mechanism closely related to RNAi (Dalmay et al., 2001). mael encodes an evolutionarily conserved protein that is required for the proper localization of Ago2 and Dicer, two components of the RNAi machinery (Findley et al., 2003). aub and spn-E encode a member of the PIWI class of Argonaute proteins and a DExH RNA helicase, respectively (Gillespie and Berg, 1995; Harris and Macdonald, 2001; Schupbach and Wieschaus, 1991; Wilson et al., 1996). Aub and spn-E are involved in the silencing of some classes of transposable elements and tandem repeats in the germline, in heterochromatin formation, in double-stranded RNA (dsRNA)-mediated RNAi in embryos and in the defense against viruses (Aravin et al., 2004; Kennerdell et al., 2002; Pal-Bhadra et al., 2004; Savitsky et al., 2006; Wang et al., 2006). Interestingly, spn-E and aub are also involved in telomere regulation (Savitsky et al., 2006). In most eukaryotes, the telomeres are maintained through the action of telomerase, the enzyme that ensures the addition of 6-8-nucleotide arrays to the chromosome ends. However, in Drosophila, telomere elongation occurs after the transposition of non-long-terminal repeat (non-LTR) HeT-A, TAHRE, and TART retrotransposons (Melnikova and Georgiev, 2005; Pardue et al., 2005). Mutations in spn-E and aub cause the upregulation of Het-A and TART expression in the germline, which, in turn, increases the frequency of telomeric element attachments to chromosome ends.

Here we show that the genes zucchini (zuc) and squash (squ) are required early during oogenesis for the translational silencing of osk mRNA and at later stages for proper expression of the Grk protein. We propose that insufficient levels of Grk protein in zuc and squ mutants are at least partially due to activity of a checkpoint that affects Grk translation, similar to the effects of DNA repair mutants in meiotic oocytes (Ghabrial and Schupbach, 1999; Klattenhof et al. 2007; Chen et al. in press). zuc encodes a member of the phospholipase-D/nuclease family (Koonin, 1996; Ponting and Kerr, 1996), while squ encodes a protein with limited similarity to RNAase HII (Itaya, 1990). We found that like Aub, Mael, and Armi proteins, Zuc and Squ localize to nuage, an electron-dense structure surrounding the nurse cell nuclei implicated in RNAi and RNA processing and transport (Bilinski et al., 2004; Snee and Macdonald, 2004). We also show that Zuc and Squ physically interact with Aub, thus pointing to a direct role for these proteins in the RNAi mechanisms. In further support of this conclusion, we demonstrate that zuc and squ are required for the biogenesis of rasiRNAs in ovaries and testes. Accordingly, mutations in these genes abolish the production of this class of siRNAs and lead to the deregulation of transposable elements and tandem repeats in the Drosophila germline.

Results

Zucchini and Squash cause dorso-ventral patterning defects and egg chamber abnormalities during oogenesis

zuc and squ were identified in a screen for female sterile mutations on chromosome II of Drosophila (Schupbach and Wieschaus, 1991). zuc and squ mutant females are viable, but produce eggs with a range of DV patterning defects. The most severe allele of zuc, zucHM27, lays few eggs, all of which are completely ventralized and often collapsed, whereas the weaker alleles, zucSG63 and zucRS49 produce some eggs with a more normal eggshell phenotype in addition to the ventralized eggs (Table 1). In addition, a P-element insertion in the coding region of the gene also acts as a strong loss-of-function allele with ventralized eggshell phenotypes. Three independent alleles of squ were recovered from the screen, namely squHE47, squPP32 and squHK3 and these alleles also generate a range of ventralized eggshell phenotypes (Table 1).

Table 1

GenotypeTotal # eggs(wild type-like)Single appendage or fused at baseNo appendage or collapsed
ZucHM27/Df(2l)PRL3703.2%10.2%86.4%
ZucSG63/Df(2l)PRL3598%17.8%74.17
zucRS49/zucRS4938551.6%10.3%38.1%
squHE /squPP10180.4%55.4%44.2%
squHE chk2/squPP chk254490.6%9.3%0

Similar eggshell phenotypes have been described for mutations in other spindle class genes, which includes both DNA repair enzymes such as spindle-B (spn-B) or okra (okr), as well as the RNAi components spn-E, aub, and mael (Gonzalez-Reyes et al., 1997; Ghabrial et al., 1998; Findley et al., 2003). Similar to the spindle class mutants, several additional developmental defects can be observed in the zuc and squ mutants during oogenesis. In the wild type oocyte, the nucleus condenses in a compact sphere, known as karyosome (Fig 1G). In contrast, the DNA in the nuclei of zuc and squ oocytes appears dispersed or in separate structures (Fig 1H, I). Since compaction of chromatin in the karyosome occurs at stage 3, the defects observed in zuc and squ egg chambers indicate a function for the genes in the early development of the oocyte. Similar to spnE mutants (Gillespie and Berg, 1995), in a small number of zuc and squ egg chambers the oocyte is not positioned at the posterior as in wild type, but is found in the middle of the egg chamber. Finally, fusion of egg chambers can also be observed in zuc mutants, resulting in egg chambers with 30 nurse cells and two oocytes. Many egg chambers in the zuc mutant undergo degeneration at different stages.

An external file that holds a picture, illustration, etc. Object name is nihms25278f1.jpg
Grk expression pattern and karyosome defects in squ and zuc egg chambers

In the wild type oocyte (A) Grk protein is found in a cap above the nucleus by stage 9 of oogenesis, where it signals the dorsal fate to the surrounding epithelial cells. In zuc (B) and squ (C) oocytes, the levels of Grk protein are severely reduced and often the protein is completely absent. However, in situ hybridization with a grk probe reveals that similar to the wildtype oocyte (D), the grk transcript is for the most part correctly localized in zuc (E) and squ (F) oocytes. By stage 3 of oogenesis the DNA of the oocyte nucleus forms a compact sphere called karyosome in the wild type (G). In zuc (H) and squ (I) oocytes, the DNA is more dispersed or fragmented, thus indicating a function in early oogenesis for these genes.

Grk expression is affected in zuc and squ mutants

The DV patterning defects suggested that the Gurken protein is not properly expressed in the mutant egg chambers. In earlier stages of oogenesis, we detected Grk protein in the oocyte similar to the wild type egg chambers. At stage 9 in wild type oocytes, Grk is localized in a cap above the oocyte nucleus, where it specifies the dorsal fate of the adjacent follicle cells (Fig 1A). In zuc mutants, the amount of Grk protein found in the dorsal-anterior corner of the oocyte is strongly reduced or absent (Fig 1B), suggesting that zuc controls the expression of Grk during mid-oogenesis. To further address this question, we analyzed the distribution pattern of the grk transcript in wild type and zuc mutant egg chambers. In wild type, grk mRNA localization mirrors the distribution of the protein and is found in the dorsal-anterior corner of the oocyte (Fig 1D). Similarly, in zuc mutant egg chambers, grk mRNA is properly localized during mid-oogenesis (Fig 1E). zuc therefore affects accumulation of the Grk protein in mid-oogenesis most likely affecting the translation of the transcripts. This phenotype is also characteristic of the spindle class mutants in general (Ghabrial and Schupbach, 1999).

In squ mutants, Grk protein also fails to accumulate properly in the oocyte at stage 9 (Fig 1C). Similar to zuc, analysis of grk transcripts in these mutants revealed that the grk mRNA is correctly localized in the majority of the squ egg chambers in mid-oogenesis (Fig 1F). This result suggests that squ is also required for Grk translation.

zuc and squ do not belong to the spindle class of DNA repair genes

The analysis of the zuc and squ egg chambers revealed defects, which place them into the spindle class genes (Gonzalez-Reyes et al., 1997). The spindle genes can be grouped into different categories: the DNA repair genes, the RNAi genes, and a class of translational regulators. The DNA repair genes are implicated in the repair of DNA double-strand breaks which are induced during meiotic recombination by the topoisomerase Mei-W68, a homolog of yeast Spo11 (McKim and Hayashi-Hagihara, 1998). Mutations in these DNA repair genes result in the activation of a meiotic checkpoint mediated by mei-41, the Drosophila ATR homologue. Mei-41 activates the kinase Chk2 also called Mnk in Drosophila, and the activity of Chk2 results in a down-regulation of Gurken translation (Abdu et al., 2002; Ghabrial and Schupbach, 1999). The resulting reduction in Gurken protein accumulation leads to the ventralized eggshell phenotype. As predicted for a mediator between DNA damage and grk translation, mutations in mei-41 and chk2 are able to suppress the phenotypes caused by mutations in the DNA repair genes (Abdu et al., 2002). Accordingly, wild type morphology is restored, for instance, in the eggs of flies doubly mutant for spn-B and mei-41. To assess whether zuc and squ belong to the DNA repair genes, we generated zuc; mei-41 and squ; mei-41 double mutant flies and checked the eggs laid by these females for the presence of DV patterning defects. In both cases, we observed the persistence of dorso-ventral patterning defects, indicating that zuc and squ do not likely belong to the class of DNA repair enzymes. We also generated flies doubly mutant for zuc and chk2 and squ and chk2. Interestingly, we found that while patterning defects persist in the eggs of zuc chk2 flies, wild type morphology is restored in the eggs laid by squ chk2 homozygous females (Table 1). Suppression of the eggshell ventralization phenotypes was also observed in chk2 aub mutants, but not in chk2; spn-E or chk2 piwi double mutants (data not shown, and Chen et al., in press). This demonstrates that a checkpoint mediated by Chk2 is largely responsible for the low levels of Grk protein in aub and squ mutants. The fact that zuc, spnE and piwi phenotypes are not suppressed by chk2 mutations suggests that they may have multiple effects on oogenesis, some of which may act independent of checkpoint activity.

Molecular analysis of the zuc and squ genes

A set of deficiencies was used to map the zuc mutation to the region 33B5 of chromosome II. Transformation rescue experiments narrowed the region to a candidate region of 5 kb, containing two transcripts: CG12314 and CG16969. Sequence analysis revealed that all the zuc mutations reside in CG12314 (Fig. 2A). zuc encodes a member of the phospholipase-D/nuclease family and is characterized by one copy of a conserved H(X)K(X4)D (HKD) motif (Fig. 2B) (Koonin, 1996; Ponting and Kerr, 1996). Notably, members of the family having two HKD domains are classified as phospholipase-D proteins, while members with one HKD domain have been shown to catalyze the hydrolysis of double-stranded RNA and DNA molecules in vitro. Hence, zuc is likely to be a nuclease. The Histidine (H) residue of the HKD domain (Fig 2A) is essential for the function of the PhospholipaseD/nuclease proteins since substitution of the H residue results in a strong reduction of the catalytic activity in vitro (Sung et al., 1997). Interestingly, the substitution of the H of the catalytic domain with a Tyrosine in the zucSG63 allele generates a strong loss-of-function allele. zucHM27 is generated by the introduction of a stop codon at residue 5, resulting in a putative protein null allele. Finally, the zucRS49 allele contains a substitution of the Serine47 with an Aspartic acid residue. Transformation rescue experiments confirmed that CG12314 corresponds to zuc. Recombination mapping placed squ on the left arm of the second chromosome at map position 2-53 (Schüpbach and Wieschaus, 1991). Deficiency mapping and P-element mediated male recombination placed squ into a region containing 6 candidate genes including her and grp (Chen et al., 1998). Complementation tests and sequence analysis argued against the six genes as candidates to be squ. Upon closer inspection of the grp locus we noticed a gene, CG4711, nested in the first intron, which had previously been predicted to encode an alternate splice exon of grp. We sequenced CG4711 in squHE47, squPP32 and squHK35 and found that squHE47 and squPP32 both contain single nucleotide changes resulting in nonsense codons in CG4711 at residues 100 and 111 respectively (Fig. 2A). No mutations were identified in the predicted CG4711 coding region in squHK35. Transformation rescue experiments confirmed that CG4711 corresponds to squ. This gene encodes a protein with similarity to RNAase HII (Fig. 2C), which is known to catalyze the degradation of RNA moieties in DNA-RNA hybrids (Itaya, 1990).

An external file that holds a picture, illustration, etc. Object name is nihms25278f2.jpg
Structure of Zuc and Squ proteins and alignment of Zuc and Squ with homologous proteins

(A) Alleles of zuc and squ. zucHM27 contains a stop codon at residue 5, zucRS49 a substitution of the Alanine 47 with an Aspartic Acid residue, zucSG63 a substitution of the Hystidine 169 in the conserved HKD domain with a Tyrosine. squHE47 and squPP32 are generated by insertion of stop codons at residues 100 and 111 respectively. (B) Alignment of Zuc with the putative human homologue LOC201164 (GenBank) and the bacterial nuclease Nuc. The HKD domain (black box) is conserved in all the proteins. (C) Alignment of Drosophila Squ protein with Agrobacterium tumefaciens RNAse HII (Agrt RNAse HII). These proteins share significant identities in their N-terminal regions. Asterisks mark the conserved residues. Dashes mark similar aminoacids.

Zuc and Squ localize to the nuage and physically interact with Aub

The “nuage” is a cytoplasmic organelle that is widely conserved in evolution. Homologous structures exist in all eukaryotic organisms and are thought to play a fundamental role in germline functions (Eddy, 1975). In Drosophila, the nuage appears as an electrondense, punctate fibrous structure that surrounds the nuclei of the nurse cells in the egg chambers (Mahowald, 1971). This organelle is thought to be a staging site where ribonucleoprotein complexes originating in the nuclei are remodeled, before they are transported to specific localizations in the cells. Recent studies have also shown that the nuage is implicated in RNAi. For instance, in human cell lines Ago1 and Ago2 proteins localize to cytoplasmic bodies, called P-bodies, which are thought to be homologous to the Drosophila nuage (Liu et al., 2005; Sen and Blau, 2005). Similar to the P-bodies, Drosophila nuage hosts molecules required in RNAi phenomena like Aub, Armi and Mael. In addition, mutations in mael, another component of the RNAi machinery, disturb the nuage granules, resulting in a displacement of the RISC components Ago2 and Dcr1 (Findley et al., 2003). To analyze the expression pattern of Zuc during oogenesis, we produced transgenic lines that express Zuc fused to EGFP (Fig. 3A). Live imaging on ovaries dissected from these lines show a strong accumulation of Zuc in the nuage. Zuc is also found in cytoplasmic particles. Immunostaining on lines expressing Zuc fused to triple HA tag confirmed these observations (data not shown). Similar to Zuc, Squ protein localizes to the nuage and in cytoplasmic particles as demonstrated by the immuno localization analysis of triple-HA-Squ transgenic lines (Fig. 3B).

An external file that holds a picture, illustration, etc. Object name is nihms25278f3.jpg
Zuc and Squ proteins localize to the nuage and physically interact with Aub

The nuage is a perinuclear fibrous structure, which has been implicated in RNAi. (A) Expression of a EGFP-Zuc fusion protein in nurse cells under the control of a Nos-Gal4-VP16 driver. Live imaging on transgenic egg chambers shows a perinuclear localization of EGFP-Zuc. EGFP-Zuc protein is also detectable in cytoplasmic particles in nurse cells.

(B) Expression of HA-Squ protein under the control of the Nos-Gal4-VP16 driver visualized with anti HA antibody. Squ also localizes to the nuage and to cytoplasmic particles.

(C) Physical interaction of Zuc and Squ with Aub.

Nos-Gal4-VP16 UAS-aub-gfp lines were crossed to UAS-HA-zuc transgenic strains and IP was performed on doubly transgenic ovaries using an anti GFP antibody. A strong band corresponding to the HA-Zuc protein can be detected in the ovarian extracts of doubly transgenic flies, while no signal above the background is visible in the IP lane of the control HA-Zuc lines. Similarly, nos-Gal4-VP16 UAS-aub-gfp lines were crossed to UAS-HA-squ transgenic strains and IP was performed on doubly transgenic flies. A band corresponding to HA-Squ can be observed in the lane of doubly transgenic ovaries, which is not present in the control lane. Additional bands are generated by an unspecific cross-reaction of the antibody. SN represents the unbound fraction of the IP.

Our results show that Zuc and Squ localize to the nuage similar to Aub. aub encodes a member of the Piwi class of Ago proteins and has been shown to be implicated in different RNAi processes in Drosophila germline. Furthermore, the inability of aub mutants to assemble RNAi complexes in the germline led to the hypothesis that Aub might be a core component for RNAi-induced complexes in this tissue (Tomari et al., 2004). Remarkably, we found that both Zuc and Squ interact with Aub in vivo, consistent with the cellular localization of these proteins (Fig. 3C). AubGFP lines were crossed to triple-HA-Zuc and triple-HA-Squ strains respectively. CoIP was performed with GFP and HA specific antibodies on ovaries of doubly transgenic flies. Bands corresponding to HA-Zuc and HA-Squ are detected in the IP lanes, while no signal above background is present in the control lanes.

Mutations in zuc and squ activate the expression of Osk in early oocytes

A hallmark of the spindle class genes that are involved in RNAi is the control of Osk translation at early stages of development (Cook et al., 2004). In wild type oocytes, osk mRNA is silenced from stage 1 to 6 through RNAi dependent mechanisms (Fig 4A). The translational repression of osk mRNAs at these stages is thought to involve the miRNA miR280 (Tomari et al., 2004). In contrast, ectopic translation of Osk is observed in early stages of armi, aub, spnE and mael mutant egg chambers. To assess whether zuc and squ are involved in RNAi, we analyzed the expression pattern of Osk in zuc and squ mutant egg chambers (Fig 4B and 4C, respectively). We found that Osk is properly translated and localized at late stages of oogenesis, where it is found at the posterior pole of the oocyte (data not shown). However, in early egg chambers Osk expression is ectopically activated and clumps of Osk protein can be observed in the developing oocyte in zuc and squ egg chambers. Osk protein is also found in punctae surrounding the nurse cell nuclei. These results suggest that zuc and squ are involved in the RNAi silencing of osk mRNAs in the nurse cells and the oocyte.

An external file that holds a picture, illustration, etc. Object name is nihms25278f4.jpg
Osk expression pattern in early oocytes

In wild type egg chambers (A), Osk translation is inhibited by RNAi mechanisms from stage 1 to 6. Consistent with a role in RNAi processes, zuc (B) and squ (C) mutations activate Osk expression in early oocytes. Osk protein forms clumps in the oocyte of the mutants and is found in punctae surrounding the nurse cells nuclei in the egg chambers.

Het-A and Tart expression is regulated by zuc and squ

To further test the involvement of zuc and squ in RNAi, we analyzed the expression levels of Het-A and Tart, two telomere-specific retrotransposons, in the ovaries of zuc and squ mutants. In Drosophila, telomere maintenance is achieved through the transposition of retrotransposons to the chromosome ends (Pardue et al., 2005). The telomere elements in Drosophila are non-LTR containing retrotransposons, which transpose to the chromosome ends via a poly(A)+ RNA intermediate. The mechanism of transposition is well characterized and recent work has shown that the RNAi machinery is involved in the maintenance of the telomeres (Savitsky et al., 2006). Aub and spnE have been shown to regulate the expression of a number of transposable elements in the germline of Drosophila (Aravin et al., 2001). In particular, mutations in aub and spnE were discovered to trigger the upregulation of the Het-A and Tart elements, two telomere-specific retrotransposons. This process occurs in the germline of Drosophila, but not in the soma, and results in the addition of extra elements to the telomere array. Since Zuc and Squ are found in a complex with Aub, we tested whether they also share a similar function in this process. To this aim, quantitative RT-PCR was performed on total RNA extracted from heterozygous zucHm27/+ and trans-heterozygous zucHm27/Df(2L)PRL ovaries (Fig. 5A). Df(2L)PRL is a deletion that uncovers the genomic region containing the zuc gene. Comparison of the two samples reveals more than 1000-fold upregulation of the Het-A element in the germline of zucHm27/Df(2L)PRL flies. A significant increase in the expression levels of Tart can be observed in zuc mutants, where this element is upregulated by 15 fold. Elevated levels of Het-A, but not Tart, can be observed in the ovaries dissected from squHE47/squPP32 mutant females as compared to the control squHE47/+ flies (Fig. 5A). It is possible that the levels in the heterozygous control flies are already somewhat elevated over wild type, but since different wild type backgrounds may vary, we used heterozygous flies as control. These results show clearly that similar to aub and spnE, zuc and squ are required for the silencing of retrotransposons in the Drosophila germline.

An external file that holds a picture, illustration, etc. Object name is nihms25278f5.jpg
Het-A and Tart retro-transposable elements and Ste tandem repeats are upregulated in ovaries of zuc and squ mutants

A) Mutations in aub and spnE impair the RNAi processes thus leading to higher expression levels of some classes of transposable elements, including the telomere-specific Het-A and Tart retro-transposons (Aravin et al. 2001). Using qRT-PCR we detected approximately a 10 fold increase of Het-A levels in the germline of aub, spnE and squ mutants compared to heterozygous control flies, while the upregulation is much higher in zuc ovaries, where it reaches nearly 1500 fold increase. The Tart element seems to be less sensitive to mutations in RNAi-related genes. A 10 to 15 fold increase in the levels of Tart expression are detected in spnE and zuc, while no significant increase is observed in the germline of aub and squ. It is possible that the heterozygous control would already show a light upregulation of the transposable elements over wildtype. The levels of upregulation as calculated here are therefore a conservative estimate.

B-D) The Stellate protein is down-regulated in the testis of wild type males through RNAi mechanisms involving the Su(Ste) locus and the RNAi-related proteins SpnE, Armi and Aub. Mutations in these genes lead to inhibition of the RNAi machinery and ectopic expression of the Stellate proteins, which in turn form needle-shaped aggregates. Such crystals are absent from testis of wild type males (5B), while they can be easily detected in testis of squ (5C) and zuc (5D) mutant males.

Stellate silencing is impaired in testes of zuc and squ mutants

The Stellate (Ste) locus in Drosophila resides on the X chromosome and encodes a protein with homology to the β-subunit of protein kinase CK2 (Bozzetti et al., 1995). While the protein is normally expressed in wild type females, it is down-regulated in wild type males through the activity of RNAi-based mechanisms (Aravin et al., 2001). The Y chromosome of Drosophila contains the crystal locus, also called Suppressor of Stellate [Su(Ste)], which shares 90% degree of identity with Ste. The insertion of a Hoppel transposon in the region 3′ to Su(Ste) causes the transcription of antisense transcripts in addition to the sense mRNAs. Sense and antisense RNAs are thought to drive the dsRNA-mediated degradation of Ste target mRNAs. This mechanism is required in males to silence the approximately 200 repeats of the Ste locus located on the X chromosome (Aravin et al., 2001). In males carrying a deletion of the bulk cry locus, or mutations in RNAi genes like spnE, aub and armi, expression of Ste is relieved (Stapleton et al., 2001; Tomari et al., 2004), which in turn leads to the accumulation of needle-shaped crystals in testes and meiotic abnormalities. To test whether zuc and squ are required for the RNAi silencing of Ste tandem repeats, we stained testes of mutant males with a Ste specific antibody (Fig. 5). While no signal can be detected in wild type males (Fig. 5B), Ste crystals can be easily observed in zuc and squ mutant testes (Fig.5C and 5D, respectively). These results demonstrate that zuc and squ are required for the silencing of tandem repeats in the Drosophila germline.

rasiRNAs biogenesis is impaired in zuc and squ mutants

The up-regulation of transposable elements and tandem repeats in the germline of zuc and squ mutants pointed to a role for the Zuc and Squ proteins in the rasiRNA pathway. Hence, we sought to determine whether these proteins are involved in the biogenesis of the rasiRNAs or rather in the mechanism which causes the silencing of selfish genetic elements. To this aim, we performed Northern blot analysis on total RNA extracted from fly ovaries and testes and probed for abundant rasiRNAs (Fig. 6). In particular, we tested the level of expression of two recently cloned rasiRNAs, namely the roo rasi and the Su(Ste) rasi (Brennecke et al., 2007). To minimize the background effects, we compared the production of rasiRNAs in homozygous or transheterozygous mutants versus heterozygous flies. Hybridization with an antisense oligonucleotide to roo rasi reveals that rasiRNAs are not produced in the ovaries of flies mutant for zuc, aub and spnE (Fig. 6A). A reduction of rasiRNA levels can also be observed in the ovaries of squ mutant flies, though the production of these small RNAs is not completely abolished like in zuc, aub and spnE mutants. Hybridization of the same membranes with an antisense oligonucleotide to miR310 (Saito et al., 2006) shows that miRNA levels are not affected in the mutants we analysed. As a loading control we also performed a final hybridization with a 2S rRNA antisense probe.

An external file that holds a picture, illustration, etc. Object name is nihms25278f6.jpg
Analyses of rasiRNAs production in ovaries and testes of squ and zuc mutants

A) Northern blot analysis on total RNA extracted from fly ovaries. Membranes were probed with an antisense oligonucleotide to the abundant roo rasi (Brennecke et al., 2007) to monitor the expression of rasiRNAs in the various mutant backgrounds. Similar to aub and spnE, mutations in the zuc gene impair the production of these siRNAs. In contrast, mutations in the squ gene do not completely abolish the production of rasiRNAs in ovaries. The same membranes were stripped and reprobed with an oligonucleotide antisense to miR310 (Saito et al., 2006). None of the mutants analysed affects the biogenesis of microRNAs. As a loading control the membranes were finally hybridized with a probe antisense to the 2S rRNA. B) Northern blot analysis of total RNA extracted from fly testes. In this experiment the membranes were probed with an antisense oligonucleotide to the abundant Su(Ste) rasi (Brennecke et al., 2007). In accordance with the results described above, mutations in zuc, aub and spnE abolish the production of rasiRNAs also in testes. Mutations in squ also strongly affect the biogenesis of the rasiRNAs in this tissue. The membranes were probed with an antisense oligonucleotide to the 2S rRNA as a loading control.

Northern blots on total RNA extracted from testes were probed with an antisense oligonucleotide to Su(Ste) rasi (Fig. 6B). This experiment revealed that similar to aub and spnE, rasiRNAs are not produced in testes of flies mutant for zuc and squ. Also in this case, hybridization with a probe corresponding to 2s rRNA was used as a loading control. Our results demonstrate a role for zuc and squ in the biogenesis of rasiRNA in the Drosophila germline.

Discussion

The establishment of anterior-posterior and dorsal-ventral axis during Drosophila oogenesis is tightly regulated and relies on the proper localization and regulated translation of specific mRNAs (Nilson and Schupbach, 1999). Grk, a TGFα-related protein, is required for the establishment of anterior-posterior and dorsal-ventral axes in the developing oocyte. Osk is necessary for pole plasm assembly and for the specification of the abdominal structures in the future embryo (Vanzo and Ephrussi, 2002). Here we show that Drosophila zuc and squ control the expression of Grk and Osk, thus affecting the axial patterning of the oocyte and future embryo. The silencing of Osk at early stages is known to be controlled by RNAi dependent mechanisms (Cook et al., 2004), suggesting that Zuc and Squ are involved in RNAi processes. In support, we found that Zuc and Squ localize to the nuage and interact with Aub, a PIWI/PAZ protein that is required for the assembly of RISC complexes in the Drosophila germline. In this tissue, RNAi ensures genomic stability by silencing selfish genetic elements (Vagin et al., 2006). Consistent with a role in a silencing RNAi process we observed the upregulation of some classes of transposable elements in ovaries and expression of tandem repeats in testes of zuc and squ mutants.

Osk translation is silenced at early stages of oocyte development by the activity of RNAi-related proteins, namely Armi, Mael, Aub and spn-E (Cook et al., 2004). Similar to armi, mael, aub and spn-E, mutations in zuc and squ lead to early expression of Osk protein in stage 1-6 oocyte. miRNAs have been shown to mediate translational repression of target mRNAs by base-pairing with their 3′UTR. A computational approach revealed that osk 3′UTR contains a sequence complementary to miR-280, which is also found in a number of putative target genes, including kinesin heavy chain mRNA (Cook et al., 2004). However, the results we report here together with previous data (Vagin et al., 2006) show that miRNA biogenesis is not affected by mutations in squ, zuc, aub, armi and spnE. Therefore, we propose that Zuc and Squ, together with Aub, Armi, Mael and spn-E might act in concert to allow the the assembly of a miR-280 miRNP complex and the silencing of osk and other target genes.

Previous studies demonstrated that Aub and spn-E are implicated in the suppression of transposable element mobilization in the Drosophila germline (Aravin et al., 2001). This process is based on RNAi mechanisms and requires a class of siRNAs called rasiRNAs. rasiRNAs are particularly abundant in the Drosophila germline and are complementary to tandem repeats, transposable elements and satellite DNA (Aravin et al., 2003). It was recently reported that rasiRNAs corresponding to retro-elements, like SINE, LINE and LTR retrotransposons, are also present in mouse oocytes (Watanabe et al., 2006), thus suggesting that a conserved RNAi machinery exists in eukaryotes, which ensures genome stability by silencing selfish genetic elements. We show that, like aub and spn-E, zuc and squ regulate the expression of some classes of transposable elements and tandem repeats in the Drosophila germline. We analyzed the expression of the Het-A and Tart retrotransposable elements and found that they are upregulated in zuc and squ mutant egg chambers. In addition, expression of Ste protein, which is downregulated by dsRNA-mediated degradation of Ste mRNA in wild type males, is activated in squ and zuc mutant males. Consistent with a role in RNAi, we show that Zuc and Squ localize to the nuage together with Aub, and physically interact with Aub, a member of the PIWI class of Argonaute proteins. Interestingly Het-A and Tart are two non-LTR retrotransposable elements, which are implicated in the maintenance of telomere length in Drosophila. Upregulation of these transposons in the egg chambers of aub and spn-E mutant flies leads to a higher rate of transposition to the chromosome ends resulting in telomere elongation and chromosomal abnormalities (Savitsky et al., 2006). Here we show that zuc and squ regulate the expression of Het-A and Tart, strongly suggesting that they might be involved in telomere regulation in the Drosophila germline.

In wild type egg chambers, Grk localizes in a cap above the oocyte nucleus where it signals the dorsal identity to the surrounding follicle cells. In zuc and squ mutant egg chambers, Grk protein fails to accumulate properly in the dorsal-anterior corner of the oocyte, which results in the production of eggs with various degree of ventralization. A similar phenotype was reported for spn-B, spn-D, spn-A and okra mutants, in which the DNA double-strand breaks induced during the meiotic recombination are not efficiently repaired (Abdu et al., 2002; Ghabrial et al., 1998; Ghabrial and Schupbach, 1999; Staeva-Vieira et al., 2003). These mutations activate a meiotic checkpoint that involves the Drosophila ATR homolog mei-41, and Chk-2/mnk. The latter is likely to promote the post-translational modification of Vasa, a helicase with homology to eIF4A. This modification event is thought to cause the inhibition of Vasa activity and, consequently, the down-regulation of grk translation. However, mutations in zuc and squ are not suppressed by mutations in mei-41, supporting the conclusion that these genes do not belong to the DNA repair class. Surprisingly, mutations in chk2/mnk are able to suppress the effects of mutation in squ, and aub (Table 1, and Chen et al. in press) but not zuc, or spn-E or piwi. This result indicates that squ and aub mutations activate a checkpoint mechanism that involves Chk2, but is not absolutely dependent on Mei-41. Similar to the DNA repair mutants, the checkpoint activity of Chk2 acts to cause the ventralized eggshell phenotype in these mutants. In contrast, zuc and spn-E mutants are not suppressed in combination with the chk2 mutant, even though we find that Vas is post-translationally modified in the zuc background (data not shown) as has been reported for spnE mutations (Findley et al., 2003). This suggests that zuc and spnE may also activate the chk2-dependent checkpoint in oogenesis that modifies Vasa, a translational regulator of Grk, as seen in the DNA repair mutants (Ghabrial and Schupbach, 1999; Klattenhof et al., 2007). But Zuc and SpnE appear to affect oogenesis through additional mechanisms acting not only through Chk-2. Similarly, mutations in armi were also observed to affect oogenesis at multiple levels (Cook et al., 2004). It is therefore plausible that Zuc, Squ, SpnE, Armi and Aub all participate in the downregulation of selfish genetic elements, and that the retrotransposons and tandem repeats activity results in activation of Chk-2. Yet Zuc and Spn-E might have additional effects in oogenesis, similar to Armi, and those effects may be more direct and not mediated by a checkpoint mechanism.

Zuc is conserved in evolution and belongs to the phospholipase-D/nuclease superfamily, which contains several proteins with diverse functions (Ponting and Kerr, 1996). All the members share a conserved HKD domain that is fundamental for the catalytic activity. However, two different groups of proteins can be identified within this family. A group of protein with two HKD domains includes human and plant PLD enzymes, cardiolipin synthase, phosphatidylserine synthase and the murine toxin from Yersinia pestis. Members of the superfamily with one HKD domain include several bacterial endonucleases, like Nuc, and a helicase-like protein from E.coli. Zuc contains only one HKD domain and thus belongs to the subgroup of the nucleases. These enzymes have been shown to hydrolyze double-stranded RNA and DNA molecules in vitro, but little is known about their function in vivo. Our results demonstrate that zuc is involved in RNAi. Interestingly, it was shown that the biogenesis of the rasiRNAs does not require Dcr1 and Dcr2 and that this class of small RNAs has different size and structure when compared to other siRNAs (Vagin et al., 2006). Mutations in the zuc gene impair the production of rasiRNAs both in ovaries and testes. Therefore, Zuc is involved in the maturation of rasiRNAs and may replace Dcr1 and Dcr2 in the germline rasiRNAs mechanisms. It was recently proposed that Aub is required for the production of the rasiRNAs 5′ ends (Brennecke et al., 2007; (Gunawardane et al., 2007), while the nuclease implicated in the cleavage of the 3′ termini remains elusive. Given the strong interaction between Zuc and Aub and the absence of rasiRNAs in the zuc mutants it is tempting to speculate that Zuc might be the nuclease responsible for the production of rasiRNAs 3′ ends in Drosophila. squ encodes a protein with similarity to RNAse HII, which is known to degrade the RNA moiety in RNA-DNA hybrids (Itaya, 1990). Mutations in squ do not completely abolish the production of rasiRNAs in ovaries, thus suggesting that this protein might act in the actual silencing mechanism of target genes rather than in the biogenesis of the rasiRNAs. However, the analysis of Su(Ste) rasiRNAs in testes of squ mutants reveals that the Squ protein is essential for the production of rasiRNAs in this tissue. A possible explanation for our data is that Squ exerts a key function in testes together with Zuc, Aub, spnE and Armi to ensure the proper processing of rasiRNAs. Differently, in ovaries Squ might be partially redundant since a squ paralogue exists in Drosophila and might replace in part the function of Squ during oogenesis. Neither Zuc nor Squ are required for biosynthesis of microRNAs, suggesting that they are specific for the production of rasiRNAs.

In summary, we identified the phospholipase D/nuclease Zucchini and the RNAse HII-related protein Squash as members of RNAi processes that function in the germline of Drosophila. Similar requirements for RNAi processes have also been reported for the normal development of the mammalian germline and the germline of C. elegans (Sijen and Plasterk, 2003) and it will be interesting to determine in the future whether Zuc and Squ homologs also participate in germline RNAi in other organisms.

Experimental procedures

Drosophila strains

Oregon R flies were used as wild type controls. zuc and squ alleles were isolated from an EMS screen (Schüpbach and Wieschaus, 1991.) Squ was mapped to cytogenetic region 36A5-10 using P{EPgy2}CG31815EY05287, Df(2L)cact-225rv64, Df(2L)H20 and Df(2L)r10 stocks. zuc was mapped to cytogenetic region 33B5 using Df(2L)Prd1.7 and Df(2L)esc10. P-element mapping using P{PZ}l(2)01810 helped to narrow the candidate region. Deficiencies, balancers and marker mutations are described in flybase www.flybase.edu. Transgenic lines expressing N-terminally triple-Hemaglutanin (HA)-tagged Zuc and Squ and EGFP-tagged Zuc proteins were prepared by injection of uas-ha-zuc, uas-egfp-zuc and uas-ha-squ into yw embryos (Genetic Services Inc.). Uas-ha-squ contains the complete CG4711 coding sequence amplified from Oregon R genomic DNA using 5′ AAATCTAGAATGGCATGGGTTCCCAATTC 3′ and 5′ AAAGCGGCCGCTGCCCAATAACAAAGCCCAG 3′ primers. The CG4711 coding sequence was cloned into the pUASp P-element transformation vector containing 3 copies of HA. This transgene rescues the squ mutant phenotype when expressed with a nanos-Gal4-VP16 driver (Van Doren et al., 1998). Similarly, uas-ha-zuc contains the ORF of CG12314 amplified with primers 5′ AAAGCGGCCGCTCTTGAGCTGGATTTGGCTCC 3′ and 5′ TTTTCTAGAATGTTGATTACCCAAATAATTATG 3′ from Oregon R genomic DNA. The PCR fragment was restriction digested with Xba I and Not I. We first cloned the sequence into a pBlueScript SK+ vector, and subsequently into a pUASp vector with either a triple HA tag or an EGFP tag at the N-terminus.

Stocks of AubGFP flies were a gift from Paul Macdonald. The mei-41D3 stock was a gift from Scott Hawley. The chk2 mutant is described in Abdu et al., 2002 and Brodsky et al., 2004.

Antibody and DNA staining and RNA in situ hybridization

Ovaries and testes for all immunostaining, except HA-Squ and HA-Zuc immunostaining, were dissected in phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde in PBST (PBS + 0.3% Triton X-100) plus three volumes of heptane at room temperature for 20 minutes. Ovaries and testes were next blocked and permeabilized in 3% BSA in PBS plus Triton X-100 (1% Triton X-100 for Grk and Orb staining, 0.3% Triton X-100 for all other antibody staining) for 1 hour at room temperature. Ovaries and testes were incubated in primary antibody overnight at 4°C and in secondary antibody for 1 hour at room temperature. Monoclonal Grk antibody ID12 was diluted 1:10 (Neumann-Silberberg and Schupbach 1996). Ste antibody was a gift from William Theurkauf and was used at 1:1000 dilution. Oskar antibody was a gift from Paul Macdonald and was used at 1:1000 dilution. All secondary antibodies were diluted 1:1000 in PBST (0.3% Triton). To visualize DNA, ovaries were stained with 1 μg/ml Hoechst dye (Molecular Probes) mixed with secondary antibodies. Rhodamine labelled phalloidin was used at 1:1000 to visualize actin.

Staining of ovaries with HA antibodies was performed as previously described with the following modifications (Findley et al, 2003). Ovaries were dissected in BacPAK complete medium (BD Biosciences) at room temperature followed by a rinse in buffer B (100 mM KH2PO4/K2HPO4, pH 6.8, 450 mM KCl, 150 mM NaCl, and 20 mM MgCl2) prior to fixation.

RNA in situ hybridization and karyosome staining were performed as previously described (Tautz and Pfeifle 1989; Neuman-Silberberg and Schupbach 1994; Ghabrial and Schupbach 1999).

IP and Western analysis

Ovaries were dissected from females in cold IP Buffer (150mM NaCl; 50mM Tris pH 8.0; 0.1% NP-40). 1 Complete Mini protease inhibitor cocktail tablet (Roche) was added to 10ml of IP buffer. Ovaries were then grinded and pelleted. The supernatant was incubated with anti-GFP antibody (Clontech) for 1h at RT and then with Protein A/G PLUS-Agarose beads (Santa Cruz Biotechnology) over night at 4° C. Beads were pelleted and the supernatant (SN) was saved for western blotting. After three washes in IP buffer, the beads were added to Gavis-Lehmann protein loading buffer (5M Urea, 0.125M Tris pH 6.8, 4% SDS, 10% β-mercaptoethanol, 20% glycerol, 0.1% bromophenol blue) (Gavis and Lehmann, 1994). The samples were boiled, pelleted and run in 12% SDS-polyacrylamide gel. The gel was transferred overnight at 5V onto a nitrocellulose membrane (Amersham). After blocking for 1 hour in TBST (150 mM NaCl, 10 mM TRIS pH 8, 0.05% Tween 20) with 1 % Carnation dry milk, the membrane was incubated in mouse anti-HA antibody diluted 1:1000 in TBST for 2 hours at 4° C. The membrane was rinsed 3 times for 5 minutes in TBST followed by incubation for 1 hour at room temperature in Peroxidase Labeled Anti-Mouse antibody diluted 1:5000 in TBST (Vector Laboratories). The ECL-Western Blotting Detection Kit was used for visualization of HRP as per manufacturer's instructions. (Amersham).

Quantitative Real-Time PCR (qRT-PCR)

All flies were grown at 23° C and placed on yeast for 24h. Ovaries were hand-dissected in cold PBS and divided in triplicates such that each sample consisted of 10-12 pairs of ovaries. Total RNA was extracted with TRIzol Reagent (Invitrogen) according to manufacturer's instructions. Single strand cDNA synthesis was performed on 1u g of total RNA from each sample using the Superscript II cDNA synthesis Kit (Invitrogen). For real time PCR, the reaction consisted of 50ng first strand cDNA template, primer mix, ROX and SYBR Green PCR mix (Stratagene, La Jolla, CA) in a total volume of 25ml. Quantitative RT-PCR was performed with the ABI Prism® 7900 system (AME Bioscience). For Het-A transcripts, we used primer pair 5′-ATCCTTCACCGTCATCACCTTCCT-3′, 5′-GGTGCGTTTAGGTGAGTGTGTGTT-3′; for Tart transcripts, we used primer pair 5′-AGAGAGGGAAAGAAGGGAAAGGGA-3′, ATTTCCTGCCTGGTTAGATCGCCA-3′; we used rpr49 as internal control, with primer pair 5′-ATGACCATCCGCCCAGCATAC-3′, 5′-CTGCATGAGCAGGACCTC CAG-3′ We analyzed the data with SDS 2.1 (Applied Biosystems). Briefly, three serial ten-fold dilutions of cDNA were amplified in duplicates to construct standard curves. Standard curves generated by the software were used for extrapolation of expression level for the unknown samples based on their threshold cycle (Ct) values. All experiments were performed with at least three independent PCR reactions. Each sample was analyzed in duplicate.

Northern blot analysis for small RNAs detection

Ovaries were manually dissected with forceps into Drosophila Ringer's solution (182 mM KCl, 46 mM NaCl, 3 mM CaCl 2, 10 mM Tris-HCl, pH 7.5). RNA was isolated from ovaries using Trizol (Invitrogen). Total RNA was quantified by absorbance at 260 nm, and 30 μg of total RNA was resolved by 15% denaturing polyacrylamide/urea gel electrophoresis (Invitrogen). After electrophoresis, the polyacrylamide gel was transferred to Hybond N+ (Amersham-Pharmacia) in 0.5x TBE by semi-dry transfer (X-Cell Surelock, Invitrogen) at 20 V for 1–2 h. The RNA was crosslinked to the membrane by UV irradiation (1200 μjoules/cm; Stratalinker, Stratagene) and pre-hybridized as previously described (Lagos-Quintana et al., 2002) for 1 h at 42°C. 20 pmol of single stranded DNA probe was 5′-32P-radiolabeled with polynucleotide kinase (New England Biolabs) and 330 μCi γ-32P-ATP (7,000 μCi/mmol; New England Nuclear) and purified using a Sephadex G-25 spin column (Roche). The 32P-radiolabeled probes were hybridized for 4–12 h at 42°C. After hybridization, membranes were washed twice with 2x SSC/0.1% (w/v) sodium dodecyl sulfate (SDS) and once with 1x SSC/0.1% (w/v) SDS for 30 min. The membranes were then exposed to autoradiography for 4-24 hours. miR310 probe was previously described (Saito et al., 2006), while roo rasi and Su(Ste) rasi have been described in (Brennecke et al., 2007).

Acknowledgments

The authors would like to thank Paul Macdonald and Scott Hawley for providing fly stocks and Paul Macdonald and William Theurkauf for providing antibodies. We are grateful to Julius Brennecke, Alexei A. Aravin and Gregory Hannon for reagents and helpful suggestions regarding the rasiRNAs analysis. We thank Scott Terhune and Nir Yakoby for technical advice regarding qRT-PCR, Gail Barcelo for help with in situ hybridizations and Joe Goodhouse for help with confocal microscopy. We are very grateful to Stefano De Renzis and Girish Deshpande for critical comments on the manuscript and to members of the Schüpbach and Wieschaus laboratories for helpful discussions and suggestions. This work was supported by the Howard Hughes Medical Institute and US Public Health Service Grants PO1 CA41086 and 1 R01 GM077620.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Abdu U, Brodsky M, Schupbach T. Activation of a meiotic checkpoint during Drosophila oogenesis regulates the translation of Gurken through Chk2/Mnk. Curr Biol. 2002;12:1645–1651. [PubMed] [Google Scholar]
  • Aravin AA, Klenov MS, Vagin VV, Bantignies F, Cavalli G, Gvozdev VA. Dissection of a natural RNA silencing process in the Drosophila melanogaster germ line. Mol Cell Biol. 2004;24:6742–6750. [PMC free article] [PubMed] [Google Scholar]
  • Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T. The small RNA profile during Drosophila melanogaster development. Dev Cell. 2003;5:337–350. [PubMed] [Google Scholar]
  • Aravin AA, Naumova NM, Tulin AV, Vagin VV, Rozovsky YM, Gvozdev VA. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr Biol. 2001;11:1017–1027. [PubMed] [Google Scholar]
  • Bilinski SM, Jaglarz MK, Szymanska B, Etkin LD, Kloc M. Sm proteins, the constituents of the spliceosome, are components of nuage and mitochondrial cement in Xenopus oocytes. Exp Cell Res. 2004;299:171–178. [PubMed] [Google Scholar]
  • Bozzetti MP, Massari S, Finelli P, Meggio F, Pinna LA, Boldyreff B, Issinger OG, Palumbo G, Ciriaco C, Bonaccorsi S, et al. The Ste locus, a component of the parasitic cry-Ste system of Drosophila melanogaster, encodes a protein that forms crystals in primary spermatocytes and mimics properties of the beta subunit of casein kinase 2. Proc Natl Acad Sci U S A. 1995;92:6067–6071. [PMC free article] [PubMed] [Google Scholar]
  • Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, Hannon GJ. Discrete Small RNA-Generating Loci as Master Regulators of Transposon Activity in Drosophila. Cell 2007 [PubMed] [Google Scholar]
  • Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM. bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell. 2003;113:25–36. [PubMed] [Google Scholar]
  • Chen B, Chu T, Harms E, Gergen JP, Strickland S. Mapping of Drosophila mutations using site-specific male recombination. Genetics. 1998;149:157–163. [PMC free article] [PubMed] [Google Scholar]
  • Cook HA, Koppetsch BS, Wu J, Theurkauf WE. The Drosophila SDE3 homolog armitage is required for oskar mRNA silencing and embryonic axis specification. Cell. 2004;116:817–829. [PubMed] [Google Scholar]
  • Dalmay T, Horsefield R, Braunstein TH, Baulcombe DC. SDE3 encodes an RNA helicase required for post-transcriptional gene silencing in Arabidopsis. Embo J. 2001;20:2069–2078. [PMC free article] [PubMed] [Google Scholar]
  • Eddy EM. Germ plasm and the differentiation of the germ cell line. Int Rev Cytol. 1975;43:229–280. [PubMed] [Google Scholar]
  • Ephrussi A, Lehmann R. Induction of germ cell formation by oskar. Nature. 1992;358:387–392. [PubMed] [Google Scholar]
  • Findley SD, Tamanaha M, Clegg NJ, Ruohola-Baker H. Maelstrom, a Drosophila spindle-class gene, encodes a protein that colocalizes with Vasa and RDE1/AGO1 homolog, Aubergine, in nuage. Development. 2003;130:859–871. [PubMed] [Google Scholar]
  • Gavis ER, Lehmann R. Translational regulation of nanos by RNA localization. Nature. 1994;369:315–318. [PubMed] [Google Scholar]
  • Ghabrial A, Ray RP, Schupbach T. okra and spindle-B encode components of the RAD52 DNA repair pathway and affect meiosis and patterning in Drosophila oogenesis. Genes Dev. 1998;12:2711–2723. [PMC free article] [PubMed] [Google Scholar]
  • Ghabrial A, Schupbach T. Activation of a meiotic checkpoint regulates translation of Gurken during Drosophila oogenesis. Nat Cell Biol. 1999;1:354–357. [PubMed] [Google Scholar]
  • Gillespie DE, Berg CA. Homeless is required for RNA localization in Drosophila oogenesis and encodes a new member of the DE-H family of RNA-dependent ATPases. Genes Dev. 1995;9:2495–2508. [PubMed] [Google Scholar]
  • Gonzalez-Reyes A, Elliott H, St Johnston D. Oocyte determination and the origin of polarity in Drosophila: the role of the spindle genes. Development. 1997;124:4927–4937. [PubMed] [Google Scholar]
  • Gunawardane LS, Saito K, Nishida KM, Miyoshi K, Kawamura Y, Nagami T, Siomi H, Siomi MC. A Slicer-Mediated Mechanism for Repeat-Associated siRNA 5′ End Formation in Drosophila. Science 2007 [PubMed] [Google Scholar]
  • Harris AN, Macdonald PM. Aubergine encodes a Drosophila polar granule component required for pole cell formation and related to eIF2C. Development. 2001;128:2823–2832. [PubMed] [Google Scholar]
  • Huynh JR, St Johnston D. The origin of asymmetry: early polarisation of the Drosophila germline cyst and oocyte. Curr Biol. 2004;14:R438–449. [PubMed] [Google Scholar]
  • Itaya M. Isolation and characterization of a second RNase H (RNase HII) of Escherichia coli K-12 encoded by the rnhB gene. Proc Natl Acad Sci U S A. 1990;87:8587–8591. [PMC free article] [PubMed] [Google Scholar]
  • Kennerdell JR, Yamaguchi S, Carthew RW. RNAi is activated during Drosophila oocyte maturation in a manner dependent on aubergine and spindle-E. Genes Dev. 2002;16:1884–1889. [PMC free article] [PubMed] [Google Scholar]
  • Koonin EV. A duplicated catalytic motif in a new superfamily of phosphohydrolases and phospholipid synthases that includes poxvirus envelope proteins. Trends Biochem Sci. 1996;21:242–243. [PubMed] [Google Scholar]
  • Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T. Identification of tissue-specific microRNAs from mouse. Curr Biol. 2002;12:735–739. [PubMed] [Google Scholar]
  • Lee YS, Nakahara K, Pham JW, Kim K, He Z, Sontheimer EJ, Carthew RW. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell. 2004;117:69–81. [PubMed] [Google Scholar]
  • Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R. MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol. 2005;7:719–723. [PMC free article] [PubMed] [Google Scholar]
  • Mahowald AP. Polar granules of Drosophila. 3. The continuity of polar granules during the life cycle of Drosophila. J Exp Zool. 1971;176:329–343. [PubMed] [Google Scholar]
  • McKim KS, Hayashi-Hagihara A. mei-W68 in Drosophila melanogaster encodes a Spo11 homolog: evidence that the mechanism for initiating meiotic recombination is conserved. Genes Dev. 1998;12:2932–2942. [PMC free article] [PubMed] [Google Scholar]
  • Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded RNA. Nature. 2004;431:343–349. [PubMed] [Google Scholar]
  • Melnikova L, Georgiev P. Drosophila telomeres: the non-telomerase alternative. Chromosome Res. 2005;13:431–441. [PubMed] [Google Scholar]
  • Neuman-Silberberg FS, Schupbach T. The Drosophila dorsoventral patterning gene gurken produces a dorsally localized RNA and encodes a TGF alpha-like protein. Cell. 1993;75:165–174. [PubMed] [Google Scholar]
  • Nilson LA, Schupbach T. EGF receptor signaling in Drosophila oogenesis. Curr Top Dev Biol. 1999;44:203–243. [PubMed] [Google Scholar]
  • Pal-Bhadra M, Leibovitch BA, Gandhi SG, Rao M, Bhadra U, Birchler JA, Elgin SC. Heterochromatic silencing and HP1 localization in Drosophila are dependent on the RNAi machinery. Science. 2004;303:669–672. [PubMed] [Google Scholar]
  • Pardue ML, Rashkova S, Casacuberta E, DeBaryshe PG, George JA, Traverse KL. Two retrotransposons maintain telomeres in Drosophila. Chromosome Res. 2005;13:443–453. [PMC free article] [PubMed] [Google Scholar]
  • Ponting CP, Kerr ID. A novel family of phospholipase D homologues that includes phospholipid synthases and putative endonucleases: identification of duplicated repeats and potential active site residues. Protein Sci. 1996;5:914–922. [PMC free article] [PubMed] [Google Scholar]
  • Saito K, Ishizuka A, Siomi H, Siomi MC. Processing of pre-microRNAs by the Dicer-1-Loquacious complex in Drosophila cells. PLoS Biol. 2005;3:e235. [PMC free article] [PubMed] [Google Scholar]
  • Saito K, Nishida KM, Mori T, Kawamura Y, Miyoshi K, Nagami T, Siomi H, Siomi MC. Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Genes Dev 2006 [PMC free article] [PubMed] [Google Scholar]
  • Savitsky M, Kwon D, Georgiev P, Kalmykova A, Gvozdev V. Telomere elongation is under the control of the RNAi-based mechanism in the Drosophila germline. Genes Dev. 2006;20:345–354. [PMC free article] [PubMed] [Google Scholar]
  • Schupbach T, Wieschaus E. Female sterile mutations on the second chromosome of Drosophila melanogaster. II. Mutations blocking oogenesis or altering egg morphology. Genetics. 1991;129:1119–1136. [PMC free article] [PubMed] [Google Scholar]
  • Sen GL, Blau HM. Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat Cell Biol. 2005;7:633–636. [PubMed] [Google Scholar]
  • Sijen T, Plasterk RH. Transposon silencing in the Caenorhabditis elegans germ line by natural RNAi. Nature. 2003;426:310–314. [PubMed] [Google Scholar]
  • Snee MJ, Macdonald PM. Live imaging of nuage and polar granules: evidence against a precursor-product relationship and a novel role for Oskar in stabilization of polar granule components. J Cell Sci. 2004;117:2109–2120. [PubMed] [Google Scholar]
  • Staeva-Vieira E, Yoo S, Lehmann R. An essential role of DmRad51/SpnA in DNA repair and meiotic checkpoint control. Embo J. 2003;22:5863–5874. [PMC free article] [PubMed] [Google Scholar]
  • Stapleton W, Das S, McKee BD. A role of the Drosophila homeless gene in repression of Stellate in male meiosis. Chromosoma. 2001;110:228–240. [PubMed] [Google Scholar]
  • Sung TC, Roper RL, Zhang Y, Rudge SA, Temel R, Hammond SM, Morris AJ, Moss B, Engebrecht J, Frohman MA. Mutagenesis of phospholipase D defines a superfamily including a trans-Golgi viral protein required for poxvirus pathogenicity. Embo J. 1997;16:4519–4530. [PMC free article] [PubMed] [Google Scholar]
  • Tomari Y, Du T, Haley B, Schwarz DS, Bennett R, Cook HA, Koppetsch BS, Theurkauf WE, Zamore PD. RISC assembly defects in the Drosophila RNAi mutant armitage. Cell. 2004;116:831–841. [PubMed] [Google Scholar]
  • Vagin VV, Sigova A, Li C, Seitz H, Gvozdev V, Zamore PD. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 2006;313:320–324. [PubMed] [Google Scholar]
  • Van Doren M, Williamson AL, Lehmann R. Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr Biol. 1998;8:243–246. [PubMed] [Google Scholar]
  • Vanzo NF, Ephrussi A. Oskar anchoring restricts pole plasm formation to the posterior of the Drosophila oocyte. Development. 2002;129:3705–3714. [PubMed] [Google Scholar]
  • Wang XH, Aliyari R, Li WX, Li HW, Kim K, Carthew R, Atkinson P, Ding SW. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 2006;312:452–454. [PMC free article] [PubMed] [Google Scholar]
  • Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H. Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. Genes Dev. 2006;20:1732–1743. [PMC free article] [PubMed] [Google Scholar]
  • Wilson JE, Connell JE, Macdonald PM. aubergine enhances oskar translation in the Drosophila ovary. Development. 1996;122:1631–1639. [PubMed] [Google Scholar]
  • Zambon RA, Vakharia VN, Wu LP. RNAi is an antiviral immune response against a dsRNA virus in Drosophila melanogaster. Cell Microbiol. 2006;8:880–889. [PubMed] [Google Scholar]
-