Skip to main content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Biodivers Data J. 2016; (4): e7251.
Published online 2016 Jan 25. doi: 10.3897/BDJ.4.e7251
PMCID: PMC4759440
PMID: 26929713

Abyssal fauna of the UK-1 polymetallic nodule exploration claim, Clarion-Clipperton Zone, central Pacific Ocean: Echinodermata

Adrian G Glover,‡ Helena Wiklund,‡ Muriel Rabone,‡ Diva J Amon,§ Craig R Smith,§ Tim O'Hara,| Christopher L Mah, and Thomas G Dahlgrencorresponding author#¤
Author information Article notes Copyright and License information PMC Disclaimer

Associated Data

Supplementary Materials

Abstract

We present data from a DNA taxonomy register of the abyssal benthic Echinodermata collected as part of the Abyssal Baseline (ABYSSLINE) environmental survey cruise ‘AB01’ to the UK Seabed Resources Ltd (UKSRL) polymetallic-nodule exploration claim ‘UK-1’ in the eastern Clarion-Clipperton Zone (CCZ), central Pacific Ocean abyssal plain. Morphological and genetic data are presented for 17 species (4 Asteroidea, 4 Crinoidea, 2 Holothuroidea and 7 Ophiuroidea) identified by a combination of morphological and genetic data. No taxa matched previously published genetic sequences, but 8 taxa could be assigned to previously-described species based on morphology, although here we have used a precautionary approach in taxon assignments to avoid over-estimating species ranges. The Clarion-Clipperton Zone is a region undergoing intense exploration for potential deep-sea mineral extraction. We present these data to facilitate future taxonomic and environmental impact study by making both data and voucher materials available through curated and accessible biological collections.

Introduction

We present data from a DNA taxonomy register of the abyssal benthic Echinodermata collected as part of the Abyssal Baseline (ABYSSLINE) environmental survey cruise ‘AB01’ to the UK Seabed Resources Ltd (UKSRL) polymetallic-nodule exploration claim ‘UK-1’ in the eastern Clarion-Clipperton Zone (CCZ), central Pacific Ocean (Smith et al. 2013).

This paper is the start of an iterative approach to providing regional taxonomic synthesis for a region that is undergoing intense deep-sea mineral exploration for high-grade polymetallic nodules regulated by Sponsoring States (here the United Kingdom Government) and the International Seabed Authority (ISA 2014b, Glover and Smith 2003, Wedding et al. 2015). Our study is not yet a comprehensive faunal guide to the region, but a data paper that will be updated with new additions following future collections and analyses. New versions will contain all the data contained in the previous version, plus additional descriptions and records from future research cruises.

The abyssal zone of the world’s oceans has been defined as the seafloor between depths of 3000m and 6000m, a bathymetric zone that encompasses 54% of the geographic surface of the planet (Smith et al. 2008). Echinoderms form a characteristic and abundant group in this region. Current online data sources list 698 echinoderm species recorded at abyssal depths from between 3000m and 6000m (OBIS 2015) out of a total of 3,272 echinoderm species recorded from depths greater than 500m (Glover et al. 2015).

The Clarion-Clipperton Zone (hereafter, CCZ) is so called as it lies between the Clarion and Clipperton Fracture Zones, topographical highs that extend longitudinally across almost the entire eastern Pacific. There is no strict definition of the region, but it has come to be regarded as the area between these fracture zones that lies within international waters and encompasses the main areas of commercial interest for polymetallic-nodule mining. Areas licensed for mining by the International Seabed Authority (ISA), as well as mining reserve areas and areas protected from mining by the ISA (ISA 2014a, Wedding et al. 2013) extend from 115°W (the easternmost extent of the UK-1 claim) to approximately 158°W, and from 22°N to 2.5°S (Fig. ​(Fig.1).1). This is an area of 6 million sq km, approximately 1.7% of the ocean’s surface.

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g001.jpg

The Clarion-Clipperton Zone, central Pacific Ocean (purple box) is a 6 milllion km2 region at the time of writing containing only 290 online-databased records of echinoderm species (OBIS 2015). The UK Seabed Resources Ltd ‘UK-1’ polymetallic nodule exploration claim area is highlighted (yellow box).

Within the 6 million sq km CCZ, as defined above, current online data sources prior to this publication list only 50 known species of echinoderms from 290 records (OBIS 2015). This is obviously the result of lack of sampling and/or taxonomy given that an abundant and diverse echinoderm fauna is suspected in the region from photographic and video survey (e.g. Foell and Pawson 1986). The goal of the DNA taxonomy part of the ABYSSLINE program is to start to rectify these gaps in our knowledge and make data publically available that will eventually allow for a complete taxonomic synthesis of the CCZ supported by openly-available molecular and morphological data. Here we provide version 1.0 of the Echinodermata taxonomic synthesis from the ABYSSLINE program, consisting of taxon records, high-resolution imagery, genetic data from multiple markers and phylogenetic analysis from the first research cruise (AB01) aboard the RV Melville in October 2013. This open data publication is intended to be supported by equivalent similar data publications on the Annelida, Mollusca, Bryozoa, Cnidaria, Porifera and other taxa forming a suite of taxonomic syntheses of biodiversity in the region, supported by a contract between the company UK Seabed Resources Ltd and the Natural History Museum, London and Uni Research, Bergen, and the University of Hawaii at Manoa.

Materials and methods

It is widely accepted that knowledge of baseline biodiversity and biogeography in the CCZ is severely hampered by a lack of modern DNA-supported taxonomic studies (ISA 2014b). With this in mind, four fundamental principles underpin our methodological pipeline: (1) A sampling design pipeline with consideration to the spatial scale of the required data, the differing biases in sampling gear and the requirement for at-sea taxonomic study, (2) A field pipeline with consideration to the successful collection of high-quality specimens using live-sorting in a 'cold-chain' from depths of 4000-5000m in the central tropical Pacific, (3) A laboratory pipeline with consideration to the needs to collect both DNA sequences and morphological data in a timely and cost-effective manner suited to the immediate needs of the science community and (4) A data and sample management pipeline that includes the publication of results with consideration to the accessibility of data and materials. Our complete methodology for DNA taxonomy in the CCZ, including deployment protocols for the various sampling gears, methods for live-sorting and microscope photography at sea and details of sample and data curation are provided in a separate open-access publication (Glover et al. 2016).

Field pipeline

The ABYSSLINE environmental baseline survey includes three 30x30km survey boxes (strata), distributed across the UK-1 claim area, and an additional reference sites outside of the UK-1 claim area (Smith et al. 2013b, Glover et al. 2016). Within each survey stratum, sample sites for a variety of benthic sampling gears are selected randomly – a randomized, stratified sampling design that assumes no a priori knowledge of the benthic environment (Smith et al. 2013b). The UK-1 strata are being sampled in a series of oceanographic cruises during the course of the project, which commenced in July 2013, with the first cruise (AB01) taking place in October 2013 aboard the RV Melville. During this cruise, the first stratum was comprehensively mapped with multibeam bathymetry and sampled for a range of biological, environmental and geophysical parameters (Fig. ​(Fig.2,2, Smith et al. 2013).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g002.jpg

'UK-1 Stratum A' ABYSSLINE biological baseline survey box sited within the UK-1 polymetallic nodule exploration claim. Stratum A is a 30x30km survey box in the northern sector of the 58,000 km2 claim area. Echinoderm sample localities are indicated by green circles from the AB01 RV Melville survey cruise, October 2013. Inset map A: the site location within the central Pacific, inset map B: all the echinoderm sampling locations (including site 'ROV7' to the west). Both inset maps use GEBCO 2014 bathymetry (global 30 arc-second interval grid data set). Seafloor bathymetry from the RV Melville ABYSSLINE cruise is shown in the main map.

A comprehensive description of our DNA taxonomy pipeline is provided in Glover et al. 2016. In summary, deep-sea benthic specimens from the UK-1 Stratum A were collected using a range of oceanographic sampling gears including box core (BC), epibenthic sledge (EBS), remotely operated vehicle (ROV) and megacore (MC) (Fig. ​(Fig.2,2, Fig. ​Fig.3).3). Geographic data from sampling activities were recorded on a central GIS database. Live-sorting of sediment and specimen samples was carried out aboard the RV Melville under the ‘cold-chain’ pipeline, in which material was immediately transferred and maintained in chilled, filtered seawater held at 2-4°C (Fig. ​(Fig.3).3). Specimens were preliminarily identified at sea and imaged live using stereomicroscopes with attached digital cameras and strobe lighting. The specimens were then transferred to individual microtube vials containing an aqueous solution of 80% non-denatured ethanol, numbered and barcoded into a database and kept chilled until return to the Natural History Museum (NHM), London. Larger, megafaunal-sized, animals were sub-sampled for DNA (with the tissue and DNA sample being taken to NHM, London) with the remaining intact specimen preserved in 10% formalin solution and taken to the University of Hawaii, Honolulu, USA for further study.

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g003.jpg

ABYSSLINE UK-1 polymetallic nodule exploration claim field pipeline for DNA taxonomy. ABYSSLINE AB01 cruise sampling aboard RV Melville in October 2013. (a) Preparing Box Core (BC) for deployment, (b) BC entering the water, (c) Megacore entering the water, (d-f) Epibenthic Sledge shown on recovery in water and cod-end where samples are taken, (g) controlling BC deployment on seafloor, (h) echosounder trace showing BC approaching seabed reflection, (i) successful BC surface after recovery, 50cm x 50cm, (j) carefully sifting mud in chilled filtered seawater (approx. temp 5-7°C) to remove live animals in undamaged state, (k) live-sorting aboard ship, taking samples for DNA and photomicrographs of specimens down to <1mm in size. All images by Glover, Dahlgren & Wiklund. A more comprehensive description of our methods is provided in Glover et al. 2016.

Laboratory pipeline

Extraction of DNA was done with DNeasy Blood and Tissue Kit (Qiagen) using a Hamilton Microlab STAR Robotic Workstation. About 1800 bp of 18S, 450 bp of 16S, and 650 bp of cytochrome c oxidase subunit I (COI) were amplified using primers listed in Table ​Table1.1. PCR mixtures contained 1 µl of each primer (10µM), 2 µl template DNA and 21 µl of Red Taq DNA Polymerase 1.1X MasterMix (VWR) in a mixture of total 25 µl. The PCR amplification profile consisted of initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 94°C for 45 s, annealing at 55°C for 45 s, extension at 72°C for 2 min, and a final extension at 72°C for 10 min. PCR products were purified using Millipore Multiscreen 96-well PCR Purification System, and sequencing was performed on an ABI 3730XL DNA Analyser (Applied Biosystems) at The Natural History Museum Sequencing Facility, using the same primers as in the PCR reactions plus two internal primers for 18S (Table ​(Table11).

Table 1.

Primers used for PCR and sequencing of 18S, 16S and COI.

Primer Sequence 5'-3' Reference
18S
18SAAYCTGGTTGATCCTGCCAGT Medlin et al. 1988
18SBACCTTGTTACGACTTTTACTTCCTC Nygren and Sundberg 2003
620FTAAAGYTGYTGCAGTTAAA Nygren and Sundberg 2003
1324RCGGCCATGCACCACC Cohen et al. 1998
COI
LCO1490GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
HCO2198TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994
polyLCOGAYTATWTTCAACAAATCATAAAGATATTGG Carr et al. 2011
polyHCOTAMACTTCWGGGTGACCAAARAATCA Carr et al. 2011
16S
16SbrHCCGGTCTGAACTCAGATCACGT Palumbi 1996
Ann16SFGCGGTATCCTGACCGTRCWAAGGTA Sjölin et al. 2005

Overlapping sequence fragments were merged into consensus sequences using Geneious R6 (www.geneious.com, Kearse et al. 2012) and aligned using MAFFT (Katoh et al. 2002) for 18S and 16S, and MUSCLE (Edgar 2004) for COI, both programs used as plugins in Geneious, with default settings. Bayesian phylogenetic analyses (BA) were conducted with MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003). Analyses were run for 10-20 million generations, of which 2,5-5 million generations were discarded as burn-in.

Data pipeline

The field and laboratory pipelines created a series of databases and sample sets that were then integrated into a data-management pipeline (Fig. ​(Fig.4).4). This includes the transfer and management of data and samples between a central collections database, a molecular collections database, an online scratchpad (website for faunal data) and external repositories (e.g GenBank, WoRMS, OBIS, GBIF) through a DarwinCore archive. This provides a robust data framework to support DNA taxonomy, in which openly-available data and voucher material is key to quality data standards. A further elaboration of the data pipeline is published in Glover et al. 2016

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g004.jpg

Data and sample management workflow on the ABYSSLINE DNA taxonomy project. Processes relating to a) physical samples are shown in grey, b) institution level data in dark green and c) externally-available data in blue.

Taxonomic assignments

All future studies of biogeographic and bathymetric ranges, gene-flow, extinction risks, natural history, reproductive ecology, functional ecology and geochemical interactions of CCZ species are dependent on accurate identifications faciliated by taxonomy. This taxonomy, presented here, is itself dependent on a sound theoretical underpinning – a species concept - coupled with the availability of both raw data and voucher samples. Here we use a phylogenetic species concept, sensu Donoghue 1985 with species determined by DNA-based phylogenetic analysis and the recognition of distinct monophyletic groups as species. For those taxa where the typical morphological data that allows determination of species are missing, we provide the lowest-level taxonomic name possible, but determination to species with genetic data. For species similar to a morphologically well defined species name where we lack comparable genetic data from type material or from the type locality, or when genetic data previously published in Genbank is incompatible with ours, we use the open nomenclature expression ”cf.". Material (including archived frozen tissue) and genetic data are accessible through the Natural History Museum, London, together with the morphological data presented in this paper, original specimens for some larger (megafaunal) taxa remain in the collection of Craig R. Smith, University of Hawaii - these specimens are indicated in the taxon treatments below. As such our species hypotheses are easily open to further evaluation and iterative improvement, e.g. full descriptions for new taxa with improved data from future cruises. A localised identification field guide to the CCZ fauna will be the subject of a future publication as more species are described, but for the present we recommend DNA-based identification (barcoding) of our species coupled with morphological comparisons made possible through this publication.

Data resources

The following sections detail the phylogenetic analysis and data resources that underpins the species hypotheses presented in the taxon treatments. A full list of all taxa including Natural History Museum Accession Numbers, NHM Molecular Collection Facility (NHM-MCF) FreezerPro numbers and NCBI GenBank Accession numbers is provided in Table ​Table22.

Table 2.

Taxon treatments presented in this paper. Includes Natural History Museum global unique identifier (GUID) which link to the record in the Museum Data Portal (data.nhm.ac.uk), new NCBI GenBank accession numbers (GenBank#), ABYSSLINE Record number (ABYSSLINE_Record#) and NHM Molecular Collection Facility sample ID number (NHMUK_MCF#). Record numbers include both material archived at NHM (all tissue samples and DNA samples, plus some morphological material including whole specimens for some taxa) and material currently housed at the Craig R Smith lab, University of Hawaii (larger 'megafaunal' material indicated by CS numbers in the ABYSSLINE record#). GenBank numbers for data downloaded from GenBank for phylogenetic analysis are presented in Suppl. material 1.

Class Morphological identification GUID ABYSSLINE_
record# 		NHMUK_
MCF# 		Genbank_
CO1# 		Genbank_
16S# 		Genbank_
18S#
Asteroidea Asteroidea sp. (NHM_054) de4bd6ce-07fe-496e-bffc-67a4c6b9782c NHM_054185546311--- KU519512 KU519530
Asteroidea Asteroidea sp. (NHM_054) bc03fc1a-3613-41a2-b1f1-bf905e0fa6d0 NHM_375185546346--- KU519528 ---
Asteroidea Freyastera cf. benthophila b7ffe7a2-7be1-4d4f-b784-7aaecf0ee743 NHM_413 AB01_CS10185546349 KU519550 KU519518 KU519535
Asteroidea Freyastera cf. benthophila 16599946-2aba-4710-98e6-43c522061878 NHM_421185546363 KU519551 ------
Asteroidea Porcellanaster cf. ceruleus c57f1bd3-1b32-41e6-8e1d-0ad6472e4327 NHM_168185546321 KU519568 ------
Asteroidea Porcellanaster cf. ceruleus 7e8ca2d8-aea1-45bd-b7e0-d0575cadd82d NHM_200185546325 KU519569 ------
Asteroidea Porcellanaster cf. ceruleus 95d0bd7f-0df9-47e4-8003-cd12007d54b4 NHM_253185546332 KU519570 KU519525 KU519542
Asteroidea Porcellanaster cf. ceruleus d15a68e0-b2b3-40b4-8cab-0563609cc80d NHM_267185546329 KU519571 ------
Asteroidea Porcellanaster cf. ceruleus 76acc5a2-6e0e-4599-8104-b8e243af10c4 NHM_408185546348 KU519572 ------
Asteroidea Styracaster paucispinus 4ae2430e-549e-47f2-ba5d-0e9a08443d31 NHM_374185546345 KU519573 KU519527 KU519543
Crinoidea Crinoidea sp. (NHM_008) b2a871bf-46d5-4639-a839-427a3efa848c NHM_008185546315 KU519547 KU519514 KU519531
Crinoidea Crinoidea sp. (NHM_055) 280c758b-5287-4a13-9f45-f6a6150b37d0 NHM_055185546310 KU519548 KU519515 KU519532
Crinoidea Crinoidea sp. (NHM_056) 92825c07-a16d-4c5e-a8e9-4fbcdc8cf44a NHM_056185546309--- KU519516 KU519533
Crinoidea Crinoidea sp. (NHM_300) 2866f91e-b99e-4703-a9d3-fe1876df1da1 NHM_300185546328 KU519549 KU519517 KU519534
Holothuroidea Benthodytes cf. sanguinolenta d0062182-89dc-4deb-b746-688289783b5f NHM_216 AB01_CS03185546339 KU519546 KU519513 ---
Holothuroidea Psychropotes cf. semperiana 38c16bec-7bf9-4c2b-b862-5da460ba6c0c NHM_220 AB01_CS05185546335--- KU519526 ---
Ophiuroidea Amphioplus cf. daleus 72db478a-ea4f-4f3e-be08-95ec9fb4d20e NHM_094185546316 KU519544 ------
Ophiuroidea Amphioplus cf. daleus 15e6ddc7-3ca7-453c-bba5-f84888716505 NHM_447 AB01_CS15185546357 KU519545 KU519511 KU519529
Ophiuroidea Ophiomusium cf. glabrum c1c4d8f3-6cd5-439f-a546-943b5e2e8d8f NHM_009185546314 KU519552 ------
Ophiuroidea Ophiomusium cf. glabrum 4d6f6aaf-93fd-4629-b224-2ce8dd3320f6 NHM_124 AB01_CS02185546319 KU519553 ------
Ophiuroidea Ophiomusium cf. glabrum 2ed865af-1605-4d78-8fd8-9c7659781854 NHM_256185546331 KU519554 ------
Ophiuroidea Ophiomusium cf. glabrum 11948cb9-654f-4519-a654-f134380093ea NHM_329 AB01_CS06185546341 KU519555 KU519519 KU519536
Ophiuroidea Ophiomusium cf. glabrum 292bd655-83d6-440f-9668-82dfa4185b04 NHM_335185546342 KU519556 ------
Ophiuroidea Ophiomusium cf. glabrum 68072fc9-3e84-4202-8e97-6c9c0c5fc83d NHM_415 AB01_CS12185546351 KU519557 ------
Ophiuroidea Ophiomusium cf. glabrum 5ad996fe-134a-4625-a404-9d0cdae435d4 NHM_452185546352 KU519558 ------
Ophiuroidea Ophiotholia sp. (NHM_076) bd6fe2ce-b4ae-470e-8bdc-cf28a94c6208 NHM_076185546306 KU519559 KU519520 KU519537
Ophiuroidea Ophiotholia sp. (NHM_076) 97d40306-fe6c-4911-8e68-1f9efc3d838f NHM_078185546305 KU519560 ------
Ophiuroidea Ophiotholia sp. (NHM_076) 479218ae-813b-4736-b3f2-7eec63640ffd NHM_104185546317 KU519561 ------
Ophiuroidea Ophiotholia sp. (NHM_076) 90e22ace-ef5d-4cb5-a4a5-29fcd55ed660 NHM_119185546318 KU519562 ------
Ophiuroidea Ophiuroidea incertae sedis sp. (NHM_041) 608349ff-5adf-4e1e-8cd7-7e0e41aee222 NHM_041185546312 KU519563 KU519521 KU519538
Ophiuroidea Ophiuroidea incertae sedis sp. (NHM_072) 241d094a-568f-4194-997c-fd08f67dcdac NHM_072185546307 KU519564 KU519522 KU519539
Ophiuroidea Ophiuroidea incertae sedis sp. (NHM_303) e9f38ce3-5ed5-49f3-8713-c26de2eefd2b NHM_303185546340 KU519565 KU519523 KU519540
Ophiuroidea Ophiuroidea incertae sedis sp. (NHM_303) 93b0a70d-c74e-4735-b70e-0c6e4c6a36ff NHM_371185546344 KU519566 ------
Ophiuroidea Perlophiura profundissima f263bc90-6307-462c-9e02-7b87d20e2840 NHM_257185546330 KU519567 KU519524 KU519541

Phylogenetic analysis of the Asteroidea

Phylogenetic analysis of the Asteroidea (Fig. ​(Fig.5)5) reveals the presence of 4 distinct lineages of ABYSSLINE specimens which we interpret as the 4 species described below based on their genetic data.

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g005.jpg

Phylogenetic analysis of the Asteroidea. 50% majority rule consensus tree from the Bayesian analyses, combining the three genes 18S, 16S and COI and using in total 60 taxa. Some of the clades are collapsed in order to make the tree smaller and easier to read.

Phylogenetic analysis of the Crinoidea

Phylogenetic analysis of the Crinoidea (Fig. ​(Fig.6)6) reveals the presence of 4 distinct lineages of ABYSSLINE specimens which we interpret as the 4 species described below based on their genetic data.

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g006.jpg

Phylogenetic analysis of the Crinoidea. 50% majority rule consensus tree from the Bayesian analyses, combining the three genes 18S, 16S and COI and using in total 113 taxa. Some of the clades are collapsed in order to make the tree smaller and easier to read.

Phylogenetic analysis of the Holothuroidea

Phylogenetic analysis of the Holothuroidea (Fig. ​(Fig.7)7) reveals the presence of 2 distinct lineages of ABYSSLINE specimens which we interpret as the 2 species described below based on their genetic data.

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g007.jpg

Phylogenetic analysis of the Holothuroidea. 50% majority rule consensus tree from the Bayesian analyses, using 16S and in total 115 taxa. Some of the clades are collapsed in order to make the tree smaller and easier to read.

Phylogenetic analysis of the Ophiuroidea

Phylogenetic analysis of the Ophiuroidea (Fig. ​(Fig.8)8) the presence of 7 distinct lineages of ABYSSLINE specimens which we interpret as the 7 species described below based on their genetic data.

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g008.jpg

Phylogenetic analysis of the Ophiuroidea. 50% majority rule consensus tree from the Bayesian analyses, combining the three genes 18S, 16S and COI and using in total 79 taxa. Some of the clades are collapsed in order to make the tree smaller and easier to read.

Taxon treatments

Asteroidea sp. 'NHM_054'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: de4bd6ce-07fe-496e-bffc-67a4c6b9782c; recordNumber: NHM_054; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023476; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519512 | KU519530; Taxon: taxonConceptID: Asteroidea sp. (NHM_054); scientificName: Asteroidea; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; scientificNameAuthorship: de Blainville, 1830; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4108; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.849883333333; decimalLongitude: -116.64495; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-09; eventTime: 17:34; habitat: Abyssal plain; fieldNumber: BC04; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  2. Type status: Other material. Occurrence: catalogNumber: bc03fc1a-3613-41a2-b1f1-bf905e0fa6d0; recordNumber: NHM_375; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023517; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519528; Taxon: taxonConceptID: Asteroidea sp. (NHM_054); scientificName: Asteroidea; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; scientificNameAuthorship: de Blainville, 1830; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4182; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.933066666667; decimalLongitude: -116.71628333333; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-19; eventTime: 12:16; habitat: Abyssal plain; fieldNumber: EB05; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Voucher material NHM_54, width of disc 4.7mm. Arms absent. Medial antenna absent (Fig. ​(Fig.99).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g009.jpg

Asteroidea sp. Specimen NHM_054. (a) Dorsal. (b) Ventral. Scale bars (a,b) 2mm. Image attribution Glover, Dahlgren & Wiklund 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Morphologically and genetically close to Eremicaster sp (Fig. ​(Fig.5).5). Forms a unique monophyletic clade distinct from other AB01 specimens. No genetic matches on GenBank or Barcode of Life Database.

Freyastera benthophila

(Sladen, 1889)

Materials

  1. Type status: Other material. Occurrence: catalogNumber: b7ffe7a2-7be1-4d4f-b784-7aaecf0ee743; recordNumber: NHM_413; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023520; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519550 | KU519518 | KU519535; Taxon: taxonConceptID: Freyastera cf. benthophila; scientificName: Freyastera benthophila; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Brisingida; family: Freyellidae; genus: Freyastera; scientificNameAuthorship: (Sladen, 1889); Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4011; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.862225; decimalLongitude: -116.546215; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-21; eventTime: 00:39; habitat: Abyssal plain; fieldNumber: RV06; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  2. Type status: Other material. Occurrence: catalogNumber: 16599946-2aba-4710-98e6-43c522061878; recordNumber: NHM_421; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 3; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023523; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519551; Taxon: taxonConceptID: Freyastera cf. benthophila; scientificName: Freyastera benthophila; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Brisingida; family: Freyellidae; genus: Freyastera; scientificNameAuthorship: (Sladen, 1889); Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4011; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.862225; decimalLongitude: -116.546215; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-21; eventTime: 00:39; habitat: Abyssal plain; fieldNumber: RV06; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

15cm long arm fragments of a Freyellidae recovered from ROV biobox. Identified by DNA and morphological examination (Fig. ​(Fig.10).10). Morphological identification suggests Freyastera benthophila detailed in Sladen 1889​).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g010.jpg

Freyastera cf. benthophila Sladen, 1899. (a) Specimen NHM_413 (arm fragment) being recovered in situ from the seafloor during ROV dive RV06, (b) Additional, unsampled specimen, imaged during AB01 video survey and identified based on imagery as the same species, (c) Tentacle of specimen NHM_413 only part recovered; inset shows detail of tentacle. Scale bars (b) laser dots 242mm apart, (c) 20mm. Image attribution (a) Smith & Amon 2013, (c) Glover, Dahlgren & Wiklund 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens (Fig. ​(Fig.5).5). The speciemens differs significantly in sequence identity to the published 16S sequence of Freyastera benthophila on GenBank accession EU722993 (K2P = 0,064). The type locality of Freyastera benthophila is in South Pacific (39°41'S; 131°23'W, 4663m depth).

Porcellanaster ceruleus

Wyville Thomson, 1877

Materials

  1. Type status: Other material. Occurrence: catalogNumber: c57f1bd3-1b32-41e6-8e1d-0ad6472e4327; recordNumber: NHM_168; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023491; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519568; Taxon: taxonConceptID: Porcellanaster cf. ceruleus; scientificName: Porcellanaster ceruleus; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Paxillosida; family: Porcellanasteridae; genus: Porcellanaster ; scientificNameAuthorship: Wyville Thomson, 1877; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4084; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.963233333333; decimalLongitude: -116.56821666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-12; eventTime: 23:01; habitat: Abyssal plain; fieldNumber: BC06; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  2. Type status: Other material. Occurrence: catalogNumber: 7e8ca2d8-aea1-45bd-b7e0-d0575cadd82d; recordNumber: NHM_200; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023495; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519569; Taxon: taxonConceptID: Porcellanaster cf. ceruleus; scientificName: Porcellanaster ceruleus; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Paxillosida; family: Porcellanasteridae; genus: Porcellanaster ; scientificNameAuthorship: Wyville Thomson, 1877; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4054; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.824116666667; decimalLongitude: -116.53425; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-14; eventTime: 21:37; habitat: Abyssal plain; fieldNumber: BC07; fieldNotes: Collected from 2-5 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  3. Type status: Other material. Occurrence: catalogNumber: 95d0bd7f-0df9-47e4-8003-cd12007d54b4; recordNumber: NHM_253; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 2; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023506; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519570 | KU519525 | KU519542; Taxon: taxonConceptID: Porcellanaster cf. ceruleus; scientificName: Porcellanaster ceruleus; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Paxillosida; family: Porcellanasteridae; genus: Porcellanaster ; scientificNameAuthorship: Wyville Thomson, 1877; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4076; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.755833333333; decimalLongitude: -116.48666666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-17; eventTime: 01:50; habitat: Abyssal plain; fieldNumber: EB04; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  4. Type status: Other material. Occurrence: catalogNumber: d15a68e0-b2b3-40b4-8cab-0563609cc80d; recordNumber: NHM_267; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023509; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519571; Taxon: taxonConceptID: Porcellanaster cf. ceruleus; scientificName: Porcellanaster ceruleus; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Paxillosida; family: Porcellanasteridae; genus: Porcellanaster ; scientificNameAuthorship: Wyville Thomson, 1877; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4076; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.755833333333; decimalLongitude: -116.48666666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-17; eventTime: 01:50; habitat: Abyssal plain; fieldNumber: EB04; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  5. Type status: Other material. Occurrence: catalogNumber: 76acc5a2-6e0e-4599-8104-b8e243af10c4; recordNumber: NHM_408; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023519; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519572; Taxon: taxonConceptID: Porcellanaster cf. ceruleus; scientificName: Porcellanaster ceruleus; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Paxillosida; family: Porcellanasteridae; genus: Porcellanaster ; scientificNameAuthorship: Wyville Thomson, 1877; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4500; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.863283333333; decimalLongitude: -116.54885; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-20; eventTime: 03:39; habitat: Abyssal plain; fieldNumber: BC12; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Voucher material NHM_267 maximum width of disc 10.5mm (Fig. 11). Length of medial antenna 3.1mm- specimen NHM_253 (Fig. ​(Fig.11).11). Morphological identification matches Porcellanaster ceruleus detailed in Wywille Thomson (1877).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g011.jpg

Porcellanaster cf. ceruleus Wyville Thomson, 1877 (a) Specimen NHM_267. (b) Detail of medial antenna. (c) Detail of tube feet. (d) Specimen NHM_253. Scale bars (a) 5mm, (b) 1mm, (c) 0.5mm. Image attribution Glover, Dahlgren & Wiklund 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Morphologically matches diagnosis of Porcellanaster ceruleus Wyville Thomson, 1877. Forms a unique monophyletic clade distinct from other AB01 specimens. Sequences of this material has no genetic matches on GenBank or Barcode of Life Database. The type material of Porcellanaster ceruleus Wyville Thomson, 1877 was dredged by the Challanger SE of New York (38°34'N; 72°10'W, 2270m depth) wich is significantly separated from our collection site. We assign the tentative name Porcellanaster cf. ceruleus to this material until we have a better understanding of genetic variation within the species including data from the type locality.

Styracaster paucispinus

Ludwig, 1907

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 4ae2430e-549e-47f2-ba5d-0e9a08443d31; recordNumber: NHM_374; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023516; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519573 | KU519527 | KU519543; Taxon: taxonConceptID: Styracaster paucispinus; scientificName: Styracaster paucispinus; kingdom: Animalia; phylum: Echinodermata; class: Asteroidea; order: Paxillosida; family: Porcellanasteridae; genus: Styracaster; scientificNameAuthorship: Ludwig, 1907; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4182; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.933066666667; decimalLongitude: -116.71628333333; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-19; eventTime: 12:16; habitat: Abyssal plain; fieldNumber: EB05; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Voucher material NHM_374, width of disc 8.2mm, maximum width of specimen including arms 16.5mm (Fig. ​(Fig.1212).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g012.jpg

Styracaster paucispinus Ludwig, 1907. Specimen NHM_374 (a) Dorsal. (b) Detail of dorsal surface. (c) Ventral. (d) Ventral feet. Scale bars (a) 2mm, (b) 0.5mm, (c) 2mm. Image attribution Glover, Dahlgren & Wiklund 2015

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Morphologically matches diagnosis of Styracaster paucispinus based on descriptions in Madsen 1961, Ludwig 1905 and material from the USNM collections with taxonomic adjustments from Mah 2015. Forms a unique monophyletic clade distinct from other AB01 specimens. No genetic matches on GenBank or Barcode of Life Database. The type material was collected in the Pacific Ocean at a similar depth to our material (8°30'S; 85°36'W, 4300m depth).

Crinoidea sp. 'NHM_008'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: b2a871bf-46d5-4639-a839-427a3efa848c; recordNumber: NHM_008; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023472; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519547 | KU519514 | KU519531; Taxon: taxonConceptID: Crinoidea sp. (NHM_008); scientificName: Crinoidea; kingdom: Animalia; phylum: Echinodermata; class: Crinoidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4171; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.881666666667; decimalLongitude: -116.46666666667; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-08; eventTime: 17:15; habitat: Abyssal plain; fieldNumber: BC03; fieldNotes: Collected from polymetallic nodule found in benthic sediment; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Calyx 1.5mm long and 1.4mm wide with arms possibly incomplete. Arms present with 0.24mm in width, 0.95mm in length. Total length of calyx and distal part of stalk preserved 6.5mm. Stalk 0.32mm in width, stalk columnals approx 1mm in length. (Fig. ​(Fig.1313)

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g013.jpg

Crinoidea sp. Specimen NHM_008. (a) Specimen attached to polymetallic nodule, live photograph, after recovery from box core. (b) Preserved specimen following DNA extraction. (c) Detail of crown, calyx and basals. Scale bars (a) 3mm, (b) 1mm, (c) 0.5mm. Image attribution Glover, Dahlgren & Wiklund 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Morphologically close to Hyocrinus foelli Roux and Pawson 1999 but incomplete specimen prevents full identification. Forms a unique monophyletic clade distinct from other AB01 specimens. No genetic matches on GenBank or Barcode of Life Database.

Ecology

Specimen observed live on a small potato-sized polymetallic nodule from the eastern CCZ abyssal plain.

Crinoidea sp. 'NHM_055'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 280c758b-5287-4a13-9f45-f6a6150b37d0; recordNumber: NHM_055; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 2; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023477; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519548 | KU519515 | KU519532; Taxon: taxonConceptID: Crinoidea sp. (NHM_055); scientificName: Crinoidea; kingdom: Animalia; phylum: Echinodermata; class: Crinoidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4108; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.849883333333; decimalLongitude: -116.64495; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-09; eventTime: 17:34; habitat: Abyssal plain; fieldNumber: BC04; fieldNotes: Collected from polymetallic nodule found in benthic sediment; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Specimen including stalk and crown, calyx with arms, 8mm in total length, 5 arms, 0.31mm in width, as present in original specimen, prior to DNA sampling, with length 1.3mm from distal portion of calyx. Distally, pinnules observed on arms (Fig. ​(Fig.1414).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g014.jpg

Crinoidea sp. Specimen NHM_055. (a) Specimen after removal from polymetallic nodule. (b) Detail of crown, calyx and arms as present after DNA extraction from 2 arms. Scale bars (a) 2mm, (b) 0.5mm. Image attribution Glover, Dahlgren & Wiklund 2015

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. No genetic matches on GenBank or Barcode of Life Database.

Ecology

Found living on polymetallic nodule.

Crinoidea sp. 'NHM_056'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 92825c07-a16d-4c5e-a8e9-4fbcdc8cf44a; recordNumber: NHM_056; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023479; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519516 | KU519533; Taxon: taxonConceptID: Crinoidea sp. (NHM_056); scientificName: Crinoidea; kingdom: Animalia; phylum: Echinodermata; class: Crinoidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4108; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.849883333333; decimalLongitude: -116.64495; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-09; eventTime: 17:34; habitat: Abyssal plain; fieldNumber: BC04; fieldNotes: Collected from polymetallic nodule found in benthic sediment; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Specimen including stalk and crown, calyx with proximal arms only, 5mm in total length. Calyx 0.62mm in width, including proximal arms 0.86mm in length. Distally, pinnules observed on arms arising laterally from arms (Fig. ​(Fig.1515).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g015.jpg

Crinoidea sp. Specimen NHM_056. (a) Specimen after removal from polymetallic nodule. (b) Detail of crown, calyx, pinnules and arms as present after DNA extraction from stalk. Scale bars (a) 1mm, (b) 0.5mm. Image attribution Glover, Dahlgren & Wiklund 2015

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. No genetic matches on GenBank or Barcode of Life Database.

Ecology

Found on polymetallic nodule.

Crinoidea sp. 'NHM_300'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 2866f91e-b99e-4703-a9d3-fe1876df1da1; recordNumber: NHM_300; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023510; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519549 | KU519517 | KU519534; Taxon: taxonConceptID: Crinoidea sp. (NHM_300); scientificName: Crinoidea; kingdom: Animalia; phylum: Echinodermata; class: Crinoidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4076; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.755833333333; decimalLongitude: -116.48666666667; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-17; eventTime: 01:50; habitat: Abyssal plain; fieldNumber: EB04; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Specimen lacks calyx, crown, arms. Stalk 6.5mm in length, attached to nodule fragment. Columnals 1.6mm in length, 0.28mm in width (Fig. ​(Fig.1616).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g016.jpg

Crinoidea sp. Specimen NHM_300 (a) Specimen found and imaged during shipboard live-sorting. (b) Detail of columnals (crown absent). Scale bars (a) 2mm, (b) 0.5mm. Image attribution Glover, Dahlgren & Wiklund 2015

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. No genetic matches on GenBank or Barcode of Life Database. Lacks crown and calyx.

Ecology

Found on polymetallic nodule.

Benthodytes sanguinolenta

Théel, 1882

Materials

  1. Type status: Other material. Occurrence: catalogNumber: d0062182-89dc-4deb-b746-688289783b5f; recordNumber: NHM_216; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023498; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519546 | KU519513; Taxon: taxonConceptID: Benthodytes cf. sanguinolenta; scientificName: Benthodytes sanguinolenta; kingdom: Animalia; phylum: Echinodermata; class: Holothuroidea; order: Elasipodida; family: Psychropotidae; genus: Benthodytes; scientificNameAuthorship: Théel, 1882; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4063; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.9629; decimalLongitude: -116.5513; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, David Pawson, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-15; eventTime: 23:15; habitat: Abyssal plain; fieldNumber: RV03; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Morphologically agrees with either Benthodytes sanguinolenta or Benthodytes typica both from Théel 1882 (Fig. ​(Fig.1717).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g017.jpg

Benthodytes cf. sanguinolenta Théel, 1882. Specimen NHM_216. (a) Specimen NHM_216 in situ on seafloor shortly before collection by ROV manipulator arm, (b) Live specimen photographed immediately after recovery from the ROV biobox, upper (dorsal view), lower (ventral view). Scale bar 5cm. Image attribution (a) Smith & Amon 2013, (b) Glover, Dahlgren & Wiklund, 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens and no match (16S) to any GenBank or BOLD databases. Morphologically consistent with Benthodytes sanguinolenta or B. typica. The type locality of B. sanguinolenta is in the Pacific ocean (34°7'S; 73°56'W, 4000m depth) while type locality of B. typica is Atlantic (35°47'N; 8°23'W, 2000m depth) (Théel 1882). We assign the tentative name Benthodytes cf. sanguinolent to this material until we have a better understanding of genetic variation within the species B. sanguinolenta and B. typica including data from the type localities.

Ecology

Observed moving on the seabed amongst polymetallic nodules.

Psychropotes semperiana

Théel, 1882

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 38c16bec-7bf9-4c2b-b862-5da460ba6c0c; recordNumber: NHM_220; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023502; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519526; Taxon: taxonConceptID: Psychropotes cf. semperiana; scientificName: Psychropotes semperiana; kingdom: Animalia; phylum: Echinodermata; class: Holothuroidea; order: Elasipodida; family: Psychropotidae; genus: Psychropotes; scientificNameAuthorship: Théel, 1882; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4062; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.962791666667; decimalLongitude: -116.55092666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, David Pawson, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-15; eventTime: 22:40; habitat: Abyssal plain; fieldNumber: RV03; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Distinctive large holothurian with sail, close morphological match to Psychropotes semperiana from Théel 1882​ (Fig. ​(Fig.1818).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g018.jpg

Psychropotes cf. semperiana Théel, 1882. Specimen NHM_220. (a) Live specimen photographed in-situ on the seafloor. (b) Same specimen dorsal view after recovery by ROV imaged underwater in cold-water tank. (c) Ventral view. Scale bars (c) 10cm. Image attribution (a) Smith & Amon 2013, (b) Glover, Dahlgren & Wiklund, 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens and no match to any GenBank or BOLD databases. Morphologically consistent with Psychropotes semperiana Théel, 1882. The type locality of Psychropotes semperiana is Atlantic (5°48'N; 14°20'W, 4500m depth) and we use the tentative name Psychropotes cf. semperiana for this material until we have a better understanding of genetic variation within the species including data from the type locality.

Ecology

Observed moving on the seabed amongst polymetallic nodules.

Amphioplus daleus

Lyman, 1879

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 72db478a-ea4f-4f3e-be08-95ec9fb4d20e; recordNumber: NHM_094; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023485; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519544; Taxon: taxonConceptID: Amphioplus cf. daleus; scientificName: Amphioplus (Unioplus) daleus; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Amphiuridae; genus: Amphioplus; subgenus: Amphioplus (Unioplus); scientificNameAuthorship: Lyman, 1879; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4081; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.79335; decimalLongitude: -116.70308333333; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-11; eventTime: 12:30; habitat: Abyssal plain; fieldNumber: BC05; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  2. Type status: Other material. Occurrence: catalogNumber: 15e6ddc7-3ca7-453c-bba5-f84888716505; recordNumber: NHM_447; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023529; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519545 | KU519511 | KU519529; Taxon: taxonConceptID: Amphioplus cf. daleus; scientificName: Amphioplus (Unioplus) daleus; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; genus: Amphioplus; subgenus: Amphioplus (Unioplus); scientificNameAuthorship: Lyman, 1879; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4053; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.86335; decimalLongitude: -116.54665; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Bowers & Connelly Megacore; eventDate: 2013-10-21; eventTime: 08:48; habitat: Abyssal plain; fieldNumber: MC10; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Voucher material recovered from megacore sample, specimen with disc of 1cm diameter (Fig. ​(Fig.19).19). Additional material including juveniles recovered from box core and epibenthic sledge. Agrees with Amphioplus (Unioplus) daleus as detailed in (Lyman 1879).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g019.jpg

Amphioplus cf. daleus Lyman, 1879. (a) Live specimen NHM_447 imaged dorsal side. (b). Dorsal surface detail. (c). Ventral surface detail. (d) Juvenile, confirmed by DNA data, NHM_094. Scale bars (a) 10mm. Image attribution Glover, Dahlgren & Wiklund, 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. Morphologically consistent with Amphioplus (Unioplus) daleus Lyman 1879. No genetic data for this species yet on GenBank. The type locality of A. daleus is Atlantic (36°44’S; 46°16’W; 4800m depth) and we use the tentative name Amphioplus cf. daleus for this material until we have a better understanding of genetic variation within the species including data from the type locality.

Ecology

Recovered from a range of sampling gears, NHM_447 recovered alive in top of multiple core tube.

Ophiomusium glabrum

Lütken & Mortensen, 1899

Materials

  1. Type status: Other material. Occurrence: catalogNumber: c1c4d8f3-6cd5-439f-a546-943b5e2e8d8f; recordNumber: NHM_009; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023473; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519552; Taxon: taxonConceptID: Ophiomusium cf. glabrum; scientificName: Ophiomusium glabrum; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiolepididae; genus: Ophiomusium; scientificNameAuthorship: Lütken & Mortensen, 1899; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4171; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.881666666667; decimalLongitude: -116.46666666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-08; eventTime: 17:15; habitat: Abyssal plain; fieldNumber: BC03; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  2. Type status: Other material. Occurrence: catalogNumber: 4d6f6aaf-93fd-4629-b224-2ce8dd3320f6; recordNumber: NHM_124; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023489; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519553; Taxon: taxonConceptID: Ophiomusium cf. glabrum; scientificName: Ophiomusium glabrum; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiolepididae; genus: Ophiomusium; scientificNameAuthorship: Lütken & Mortensen, 1899; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4080; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.758333333333; decimalLongitude: -116.69851666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-11; eventTime: 10:32; habitat: Abyssal plain; fieldNumber: EB02; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  3. Type status: Other material. Occurrence: catalogNumber: 2ed865af-1605-4d78-8fd8-9c7659781854; recordNumber: NHM_256; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023507; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519554; Taxon: taxonConceptID: Ophiomusium cf. glabrum; scientificName: Ophiomusium glabrum; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiolepididae; genus: Ophiomusium; scientificNameAuthorship: Lütken & Mortensen, 1899; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4076; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.755833333333; decimalLongitude: -116.48666666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Chris Mah, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-17; eventTime: 01:50; habitat: Abyssal plain; fieldNumber: EB04; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  4. Type status: Other material. Occurrence: catalogNumber: 11948cb9-654f-4519-a654-f134380093ea; recordNumber: NHM_329; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023512; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519555 | KU519519 | KU519536; Taxon: taxonConceptID: Ophiomusium cf. glabrum; scientificName: Ophiomusium glabrum; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiolepididae; genus: Ophiomusium; scientificNameAuthorship: Lütken & Mortensen, 1899; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4075; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.76085; decimalLongitude: -116.4653; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-17; eventTime: 19:06; habitat: Abyssal plain; fieldNumber: RV05; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  5. Type status: Other material. Occurrence: catalogNumber: 292bd655-83d6-440f-9668-82dfa4185b04; recordNumber: NHM_335; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023513; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519556; Taxon: taxonConceptID: Ophiomusium cf. glabrum; scientificName: Ophiomusium glabrum; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiolepididae; genus: Ophiomusium; scientificNameAuthorship: Lütken & Mortensen, 1899; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4075; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.76085; decimalLongitude: -116.4653; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-17; eventTime: 19:06; habitat: Abyssal plain; fieldNumber: RV05; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  6. Type status: Other material. Occurrence: catalogNumber: 68072fc9-3e84-4202-8e97-6c9c0c5fc83d; recordNumber: NHM_415; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023522; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519557; Taxon: taxonConceptID: Ophiomusium cf. glabrum; scientificName: Ophiomusium glabrum; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiolepididae; genus: Ophiomusium; scientificNameAuthorship: Lütken & Mortensen, 1899; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4050; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.863666666667; decimalLongitude: -116.54431666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-20; eventTime: 10:32; habitat: Abyssal plain; fieldNumber: RV06; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  7. Type status: Other material. Occurrence: catalogNumber: 5ad996fe-134a-4625-a404-9d0cdae435d4; recordNumber: NHM_452; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023534; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519558; Taxon: taxonConceptID: Ophiomusium cf. glabrum; scientificName: Ophiomusium glabrum; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiolepididae; genus: Ophiomusium; scientificNameAuthorship: Lütken & Mortensen, 1899; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4050; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.863666666667; decimalLongitude: -116.54431666667; geodeticDatum: WGS84; Identification: identifiedBy: Diva Amon, Tim O'Hara, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: cf; Event: samplingProtocol: Remotely Operated Vehicle; eventDate: 2013-10-20; eventTime: 10:32; habitat: Abyssal plain; fieldNumber: RV06; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Voucher material, NHM_329, disc approx 20mm in diameter. Additional voucher material (12 specimens) ranges in size from 2mm to 20mm in diameter (Fig. ​(Fig.20).20). Range of polymorphs observed characterised by pattern of disc dorsal coloration (Fig. ​(Fig.20).20). Juveniles observed and identified from DNA data.

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g020.jpg

Ophiomusium cf. glabrum Lütken and Mortensen, 1899. (a) Voucher material Specimen NHM_329 with insets showing detail of dorsal and ventral surface of disc. (b) NHM_124. (c) NHM_256. (d) NHM_338. (e) Unsampled specimens of suspected O. cf glabrum imaged during ROV surveys, showing 1 specimen on sediment surface and 1 specimen partially buried in sediment (green dot is a laser scale marker, cropped here). All voucher material specimens and designations confirmed with DNA data. Scale bars (a) 20mm, (g) 2mm. Image attribution (a-d) Glover, Dahlgren & Wiklund 2015 (e) Smith & Amon 2013.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. Morphologically fits Ophiomusium cf. glabrum detailed in (Lütken and Mortensen 1899) but no genetic data available from type locality (47°22'N; 125°48'W, 1604m depth) (National Museum of Natural History, Smithsonian Institution 2015). CO1 sequences of our material is 17% different (K2P distance) from sequences published on Genbank (HM400322-HM400323).

Ecology

The most abundant brittle-star in the UK-1 exploration claim survey box UK-1 Stratum A, frequently observed by the ROV on the sediment surface and on nodules.

Ophiotholia sp. 'NHM_076'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: bd6fe2ce-b4ae-470e-8bdc-cf28a94c6208; recordNumber: NHM_076; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023482; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519559 | KU519520 | KU519537; Taxon: taxonConceptID: Ophiotholia sp. (NHM_076); scientificName: Ophiotholia; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiomycetidae; genus: Ophiotholia; scientificNameAuthorship: Lyman, 1880; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4108; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.849883333333; decimalLongitude: -116.64495; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-09; eventTime: 17:34; habitat: Abyssal plain; fieldNumber: BC04; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  2. Type status: Other material. Occurrence: catalogNumber: 97d40306-fe6c-4911-8e68-1f9efc3d838f; recordNumber: NHM_078; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023483; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519560; Taxon: taxonConceptID: Ophiotholia sp. (NHM_076); scientificName: Ophiotholia; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiomycetidae; genus: Ophiotholia; scientificNameAuthorship: Lyman, 1880; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4108; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.849883333333; decimalLongitude: -116.64495; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-09; eventTime: 17:34; habitat: Abyssal plain; fieldNumber: BC04; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  3. Type status: Other material. Occurrence: catalogNumber: 479218ae-813b-4736-b3f2-7eec63640ffd; recordNumber: NHM_104; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023486; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519561; Taxon: taxonConceptID: Ophiotholia sp. (NHM_076); scientificName: Ophiotholia; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiomycetidae; genus: Ophiotholia; scientificNameAuthorship: Lyman, 1880; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4081; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.79335; decimalLongitude: -116.70308333333; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-11; eventTime: 12:30; habitat: Abyssal plain; fieldNumber: BC05; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  4. Type status: Other material. Occurrence: catalogNumber: 90e22ace-ef5d-4cb5-a4a5-29fcd55ed660; recordNumber: NHM_119; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023487; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519562; Taxon: taxonConceptID: Ophiotholia sp. (NHM_076); scientificName: Ophiotholia; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurina; family: Ophiomycetidae; genus: Ophiotholia; scientificNameAuthorship: Lyman, 1880; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4081; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.79335; decimalLongitude: -116.70308333333; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-11; eventTime: 12:30; habitat: Abyssal plain; fieldNumber: BC05; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Voucher material, consisting of a series of fragments of arms and one partial disc. All material specimens form a monophyletic clade based on DNA. Arm processes (parasols) suggestive of Ophiotholia sp affinity. In NHM_076, arms are 0.31mm wide, with parasol-shaped processes of 0.19mm in length, parasols, 0.048mm in width (Fig. ​(Fig.2121).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g021.jpg

Ophiotholia sp. specimen fragments, identified through DNA. (a) NHM_076. (b) NHM_076 detail. (c) NHM_104. (d) NHM_78. Scale bars (a) 300µm, (b) 200µm, (c) 500µm, (d) 1mm. Image attribution Glover, Dahlgren & Wiklund, 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. Morphologically perhaps close to Ophiotholia but requires further sampling.

Ecology

Specimens recovered from two box cores, two specimens from each. Specimens from the same box cores genetically identical, so could be fragments of the same species.

Ophiuroidea incertae sedis sp. 'NHM_041'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 608349ff-5adf-4e1e-8cd7-7e0e41aee222; recordNumber: NHM_041; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023475; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519563 | KU519521 | KU519538; Taxon: taxonConceptID: Ophiuroidea incertae sedis sp. (NHM_041); scientificName: Ophiuroidea; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4336; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.8372; decimalLongitude: -116.55843333333; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: incertae sedis; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-09; eventTime: 10:26; habitat: Abyssal plain; fieldNumber: EB01; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Small disc fragments found in several samples, distinct petal arrangement visible ventrally (Fig. ​(Fig.2222).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g022.jpg

Ophiuroidea incertae sedis, specimen fragments, identified through DNA. (a) Ophiuroidea sp, NHM_072. (b) Ophiuroidea sp, NHM_041. (c) Ophiuroidea sp, NHM_303. (d) Ophiuroidea sp, NHM_371. Scale bars (b) 1mm, (c) 0.2mm. Image attribution Glover, Dahlgren & Wiklund, 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. Morphologically not recognisable.

Ophiuroidea incertae sedis sp. 'NHM_072'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: 241d094a-568f-4194-997c-fd08f67dcdac; recordNumber: NHM_072; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023481; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519564 | KU519522 | KU519539; Taxon: taxonConceptID: Ophiuroidea incertae sedis sp. (NHM_072); scientificName: Ophiuroidea; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4108; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.849883333333; decimalLongitude: -116.64495; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: incertae sedis; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-09; eventTime: 17:34; habitat: Abyssal plain; fieldNumber: BC04; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Small fragment consisting of orange-coloured disc, arms absent or missing (Fig. ​(Fig.2222).

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. Morphologically not recognisable.

Ophiuroidea incertae sedis sp. 'NHM_303'

Materials

  1. Type status: Other material. Occurrence: catalogNumber: e9f38ce3-5ed5-49f3-8713-c26de2eefd2b; recordNumber: NHM_303; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023511; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519565 | KU519523 | KU519540; Taxon: taxonConceptID: Ophiuroidea incertae sedis sp. (NHM_303); scientificName: Ophiuroidea; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4110; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.7621; decimalLongitude: -116.46375; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: incertae sedis; Event: samplingProtocol: USNEL Box Core; eventDate: 2013-10-17; eventTime: 13:40; habitat: Abyssal plain; fieldNumber: BC09; fieldNotes: Collected from 0-2 cm layer of box core using a 300 micron sieve; Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen
  2. Type status: Other material. Occurrence: catalogNumber: 93b0a70d-c74e-4735-b70e-0c6e4c6a36ff; recordNumber: NHM_371; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023515; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519566; Taxon: taxonConceptID: Ophiuroidea incertae sedis sp. (NHM_303); scientificName: Ophiuroidea; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4182; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.933066666667; decimalLongitude: -116.71628333333; geodeticDatum: WGS84; Identification: identifiedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; identificationQualifier: incertae sedis; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-19; eventTime: 12:16; habitat: Abyssal plain; fieldNumber: EB05; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Small fragments found in several samples, distinct upturned arms and prounonced hump on crest (Fig. ​(Fig.2222).

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. Morphologically not recognisable.

Perlophiura profundissima

Belyaev & Litvinova, 1972

Materials

  1. Type status: Other material. Occurrence: catalogNumber: f263bc90-6307-462c-9e02-7b87d20e2840; recordNumber: NHM_257; recordedBy: Adrian Glover, Helena Wiklund, Thomas Dahlgren, Maggie Georgieva; individualCount: 1; preparations: tissue and DNA voucher stored in 80% non-denatured ethanol aqueous solution; otherCatalogNumbers: 5023508; associatedSequences: http://www.ncbi.nlm.nih.gov/nuccore/KU519567 | KU519524 | KU519541; Taxon: taxonConceptID: Perlophiura profundissima; scientificName: Perlophiura profundissima; kingdom: Animalia; phylum: Echinodermata; class: Ophiuroidea; order: Ophiurida; family: Ophiuridae; genus: Perlophiura; scientificNameAuthorship: Belyaev & Litvinova, 1972; Location: waterBody: Pacific; stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration claim UK-1; verbatimLocality: UK-1 Stratum A; maximumDepthInMeters: 4076; locationRemarks: RV Melville Cruise MV1313; decimalLatitude: 13.755833333333; decimalLongitude: -116.48666666667; geodeticDatum: WGS84; Identification: identifiedBy: Gordon Paterson, Adrian Glover, Helena Wiklund, Thomas Dahlgren; dateIdentified: 2015-06-01; identificationRemarks: identified by DNA and morphology; Event: samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-17; eventTime: 01:50; habitat: Abyssal plain; fieldNumber: EB04; fieldNotes: Collected from epi net (on the epibenthic sledge); Record Level: language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord: PreservedSpecimen

Description

Specimen examined and matches Perlophiura profundissima Belyaev and Litvinova, 1972 (Belyaev and Litvinova 1972) voucher material, NHM_257, disc 3.1mm in diameter (Fig. ​(Fig.2323).

An external file that holds a picture, illustration, etc. Object name is biodiversity_data_journal-4-e7251-g023.jpg

Perlophiura profundissima Belyaev and Litvinova, 1972. Specimen NHM_257. (a) Live specimen imaged dorsal side. (b). Dorsal surface detail. (c). Ventral surface detail. Scale bars (a) 3mm, (b) 1mm. Image attribution Glover, Dahlgren & Wiklund, 2015.

Genetic data for this taxa with new GenBank accession numbers are provided in Table ​Table22

Diagnosis

Forms a unique monophyletic clade distinct from other AB01 specimens. Morphologically agrees with Perlophiura profundissima but no genetic data available from type locality or any location for this taxon but type locality appears to be North Pacific at abyssal depths (Belyaev and Litvinova 1972).

Discussion

Within the entire 6 million sq km Clarion Clipperton Zone, the best current online databases (OBIS 2015) list only 290 echinoderm records from 50 species. In this study, we report 48 new records from 17 species. This is an increase of ~25% for echinoderm species records from just a single 25-day cruise to a 30x30km location, with a relatively modest number of samples. All of our data are publically available through the Darwin Core outputs on this manuscript which are automatically fed into data aggregators such as GBIF and OBIS (Smith et al. 2013). All of our species determinations are supported by molecular DNA sequences, the data made available on GenBank and the voucher materials deposited in the Molecular Collections Facility of the Natural History Museum, London where they are available for future study by research visit or loan.

It is noteworthy that there was not a single 100% match for any of our sequences obtained with data on either NCBI GenBank or BOLD databases (BOLD 2015). This observation reinforces the point that there are very few taxonomic or genetic data available on the benthic biology of this region, an area undergoing intense exploration for mineral resources within the framework of the International Seabed Authority regulatory system (Wedding et al. 2015). The ISA has recently recognised the need for urgent action to make taxonomic data for the CCZ available from the large number of research cruises that are taking place supported by Sponsoring States (national governments) or private contractors (ISA 2014a). It is interesting to note that in the first 6 months of 2015 alone, there have been 3 large-scale benthic biology cruises to the eastern end of the CCZ, supported by the ABYSSLINE project (funded by UK Seabed Resources Ltd, cruise AB02), the German Government (the EU JPI cruise aboard the RV Sonne) and the EU 'MIDAS' programme (cruise JC120, partially funded by the Natural Environment Research Council, UK). As an example, from the ABYSSLINE cruise AB02 in March 2015 alone, we have an additional 289 echinoderm samples that are currently being identified and analysed for DNA; these results will be reported in future data papers over the course of the ABYSSLINE project.

The lack of comparative genetic data also has implications for our understanding of species ranges. We know that cryptic diversity is common in the deep sea (Knowlton 2000, Havermans et al. 2013, Jennings et al. 2013). With the routine use of molecular data in taxonomy, we will be better at detecting sibling species and defining species ranges, including for species considered to have distributions across multiple ocean basins and over very wide bathymetric ranges. To avoid exaggerated species ranges, we here follow a precautionary principle and have therefore avoided the use of taxon names based on morphological similarity alone unless the identity also is corroborated by a justifyable bathymetric and geographic proximity to type locality of the species name (i.e. abyssal Pacific).

The increased activity in terms of research cruises and sample collection in the CCZ make it more important than ever to provide taxonomic data quickly for an iterative building of baseline biodiversity knowledge in the CCZ region. Making these data available through rapid publication in open-access journals that support data-aggregator online systems is a key first step in this process.

Supplementary Material

Supplementary material 1

Taxa table

Data type: Genbank accession numbers

Brief description: List of taxa downloaded from GenBank that are included in the phylogenetic analyses, with their Genbank accession numbers. Accession numbers for taxa sequenced in this study are found in Table 2.

File: oo_73309.xlsx

Glover et al.

Supplementary material 2

Tree file from Asteroidea phylogenetic analyses

Data type: Phylogenetic

File: oo_61123.con

Glover et al.

Supplementary material 3

Tree file from Crinoidea phylogenetic analyses

Data type: Phylogenetic

File: oo_61124.con

Glover et al.

Supplementary material 4

Tree file from Holothuroidea phylogenetic analyses

Data type: Phylogenetic

File: oo_61125.con

Glover et al.

Supplementary material 5

Tree file from Ophiuroidea phylogenetic analyses

Data type: Phylogenetic

File: oo_61127.con

Glover et al.
XML Treatment for Asteroidea sp. 'NHM_054':
XML Treatment for Freyastera benthophila:
XML Treatment for Porcellanaster ceruleus:
XML Treatment for Styracaster paucispinus:
XML Treatment for Crinoidea sp. 'NHM_008':
XML Treatment for Crinoidea sp. 'NHM_055':
XML Treatment for Crinoidea sp. 'NHM_056':
XML Treatment for Crinoidea sp. 'NHM_300':
XML Treatment for Benthodytes sanguinolenta:
XML Treatment for Psychropotes semperiana:
XML Treatment for Amphioplus daleus:
XML Treatment for Ophiomusium glabrum:
XML Treatment for Ophiotholia sp. 'NHM_076':
XML Treatment for Ophiuroidea incertae sedis sp. 'NHM_041':
XML Treatment for Ophiuroidea incertae sedis sp. 'NHM_072':
XML Treatment for Ophiuroidea incertae sedis sp. 'NHM_303':
XML Treatment for Perlophiura profundissima:

Acknowledgements

The ABYSSLINE (ABYSSal baseLINE) environmental survey of the UK-1 exploration claim is supported by a collaborative partnership between 6 non-profit global academic research institutes (University of Hawaii at Manoa, Natural History Museum, Uni Research, National Oceanography Centre, Senckenberg Institute, IRIS Norway) and through a commercial arrangement with UK Seabed Resources Ltd. Additional support was provided by the Swedish research council FORMAS (TGD). We would like to acknowledge the support of Magdalena Georgieva from the Natural History Museum team in sampling on board ship. We would particularly like to acknowledge the expert support from the Senckenberg Institute team in the deployment and recovery of successful Brenke Epibenthic Sledge samples (Nils Brenke, Pedro Martinez and Inga Morhbeck). We would like to acknowledge the support of the entire scientific party and the Masters and Crew of the Research Vessel Melville during the first cruise of the ABYSSLINE project in October 2013. Thanks also to Jackie Mackenzie-Dodds & Chiho Ikebe (Molecular Collection Facility, NHM).

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Notes

Author contributions

Data were provided by all the authors. The manuscript was first drafted by AGG and subsequently edited by all the authors.

References

  • Belyaev G, Litvinova N. New genera and species of deep-sea ophiuroidea. Moskovskogo Obshchestva Ispytatelej Prirody. Otdel Biologicheskii. 1972;3:5–20. [Google Scholar]
  • BOLD BOLD systems. http://www.barcodinglife.org
  • Carr Christina M., Hardy Sarah M., Brown Tanya M., Macdonald Tara A., Hebert Paul D. N. A Tri-Oceanic Perspective: DNA Barcoding Reveals Geographic Structure and Cryptic Diversity in Canadian Polychaetes. http://dx.doi.org/10.1371/journal.pone.0022232. PLoS ONE. 2011;6(7):e22232. doi: 10.1371/journal.pone.0022232. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Cohen B. L., Gawthrop A., Cavalier-Smith T. Molecular phylogeny of brachiopods and phoronids based on nuclear-encoded small subunit ribosomal RNA gene sequences. http://dx.doi.org/10.1098/rstb.1998.0351. Philosophical Transactions of the Royal Society B: Biological Sciences. 1998;353(1378):2039–2061. doi: 10.1098/rstb.1998.0351. [CrossRef] [Google Scholar]
  • Donoghue Michael J. A Critique of the Biological Species Concept and Recommendations for a Phylogenetic Alternative. http://dx.doi.org/10.2307/3243026. The Bryologist. 1985;88(3):172. doi: 10.2307/3243026. [CrossRef] [Google Scholar]
  • Edgar R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. http://dx.doi.org/10.1093/nar/gkh340. Nucleic Acids Research. 2004;32(5):1792–1797. doi: 10.1093/nar/gkh340. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Foell E, Pawson D. Photographs of Invertebrate Megafauna from Abyssal Depths of the North-Eastern Equatorial Pacific Ocean. The Ohio Journal of Science. 1986;86:61–68. [Google Scholar]
  • Folmer O., Black M., Hoeh W., Lutz R., Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology. 1994;3:294–299. [PubMed] [Google Scholar]
  • Glover A. G, Smith C. R. The deep-sea floor ecosystem: current status and prospects of anthropogenic change by the year 2025. http://dx.doi.org/10.1017/s0376892903000225. Environmental Conservation. 2003;30(3):219–241. doi: 10.1017/s0376892903000225. [CrossRef] [Google Scholar]
  • Glover A. G, Higgs N. H, Horton T. World Register of Deep-Sea Species. http://www.marinespecies.org/deepsea. [2015-07-09T00:00:00+03:00];
  • Glover A. G, Dahlgren T. G, Wiklund H, Mohrbeck I, Smith C. R. An End-to-End DNA Taxonomy Methodology for Benthic Biodiversity Survey in the Clarion-Clipperton Zone, Central Pacific Abyss. http://www.mdpi.com/2077-1312/4/1/2/html. Journal of Marine Science and Engineering. 2016;4(1):2. doi: 10.3390/jmse4010002. [CrossRef] [Google Scholar]
  • Havermans Charlotte, Sonet Gontran, d’Acoz Cédric d’Udekem, Nagy Zoltán T., Martin Patrick, Brix Saskia, Riehl Torben, Agrawal Shobhit, Held Christoph. Genetic and Morphological Divergences in the Cosmopolitan Deep-Sea Amphipod Eurythenes gryllus Reveal a Diverse Abyss and a Bipolar Species. http://dx.doi.org/10.1371/journal.pone.0074218. PLoS ONE. 2013;8(9):e74218. doi: 10.1371/journal.pone.0074218. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • ISA ISA Taxonomic Standardization Workshops - Macrofauna. https://www.isa.org.jm/workshop/workshop-taxonomic-methods-and-standardization-macrofauna-clarion-clipperton-fracture-zone
  • ISA International Seabed Authority Website. http://www.isa.org.jm 2014
  • Jennings Robert M., Etter Ron J., Ficarra Lynn. Population Differentiation and Species Formation in the Deep Sea: The Potential Role of Environmental Gradients and Depth. http://dx.doi.org/10.1371/journal.pone.0077594. PLoS ONE. 2013;8(10):e77594. doi: 10.1371/journal.pone.0077594. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Katoh K., Misawa K., Kuma K., Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic acids research. 2002;30(14):3059–3066. doi: 10.1093/nar/gkf436. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz S., Duran C., Thierer T., Ashton B., Meintjes P., Drummond A. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. http://dx.doi.org/10.1093/bioinformatics/bts199. Bioinformatics. 2012;28(12):1647–1649. doi: 10.1093/bioinformatics/bts199. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Knowlton N. Molecular genetic analyses of species boundaries in the sea. Hydrobiologia. 2000;420(1):73–90. doi: 10.1007/978-94-017-2184-4_8. [CrossRef] [Google Scholar]
  • Ludwig H. Asteroidea . Memoirs of the Museum of Comparative Zoology at Harvard. 1905;32:1–292. [Google Scholar]
  • Lütken DF, Mortensen T. The Ophiuridae / by C. F. Lütken and Th. Mortensen. Memoirs of the Museum of Comparative Zoölogy, at Harvard College, Cambridge, Mass.; 1899. 95-208. [CrossRef] [Google Scholar]
  • Lyman T. Ophiuridae and Astrophytidae of the “Challenger” expedition. Part II. Bulletin of the Museum of Comparative Zoology at Harvard College, Cambridge, Mass. 1879;6(2)(2):17–83. [Google Scholar]
  • Madsen FJ. The Porcellanasteridae: A monographic revision of an abyssal group of sea-stars. Galathea Report. Vol. 4. Danish Science Press; 1961. 33-174 [Google Scholar]
  • Mah C. Porcellanasteridae Sladen, 1883. Mah C, editor. http://www.marinespecies.org/Asteroidea/aphia.php?p=taxdetails&id=123130 World Asteroidea database at http://www.marinespecies.org/Asteroidea/aphia.php?p=taxdetails&id=123130 on 2015-09-24. 2015
  • Medlin Linda, Elwood Hille J., Stickel Shawn, Sogin Mitchell L. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. http://dx.doi.org/10.1016/0378-1119(88)90066-2. Gene. 1988;71(2):491–499. doi: 10.1016/0378-1119(88)90066-2. [PubMed] [CrossRef] [Google Scholar]
  • National Museum of Natural History Smithsonian Institution. NMNH occurrence DwC-A, 2015-08-06. http://www.gbif.org/occurrence/887888747. [2015-10-21T00:00:00+03:00];
  • Nygren Arne, Sundberg Per. Phylogeny and evolution of reproductive modes in Autolytinae (Syllidae, Annelida) http://dx.doi.org/10.1016/s1055-7903(03)00095-2. Molecular Phylogenetics and Evolution. 2003;29(2):235–249. doi: 10.1016/s1055-7903(03)00095-2. [PubMed] [CrossRef] [Google Scholar]
  • OBIS Ocean Biogeographic Information System. http://www.iobis.org. [2015-07-09T00:00:00+03:00];
  • Palumbi S. R. Nucleic acid II: the polymerase chain reaction. In: Hillis D. M., Moritz G., Mable B. K., editors. Molecular Systematics. Sinauer Associates.; Sunderland, Mass.: 1996. [Google Scholar]
  • Ronquist F., Huelsenbeck J. P. MrBayes 3: Bayesian phylogenetic inference under mixed models. http://dx.doi.org/10.1093/bioinformatics/btg180. Bioinformatics. 2003;19(12):1572–1574. doi: 10.1093/bioinformatics/btg180. [PubMed] [CrossRef] [Google Scholar]
  • Roux M, Pawson D. Two New Pacific Ocean Species of Hyocrinid Crinoids (Echinodermata), with Comments on Presumed Giant-Dwarf Gradients Related to Seamounts and Abyssal Plains. Pacific Science. 1999;53:289-298. [Google Scholar]
  • Sjölin Erica, Erséus Christer, Källersjö Mari. Phylogeny of Tubificidae (Annelida, Clitellata) based on mitochondrial and nuclear sequence data. http://dx.doi.org/10.1016/j.ympev.2004.12.018. Molecular Phylogenetics and Evolution. 2005;35(2):431–441. doi: 10.1016/j.ympev.2004.12.018. [PubMed] [CrossRef] [Google Scholar]
  • Sladen WP. Report on the Asteroidea. Report on the Scientific Results of the Voyage of H.M.S. Challenger during the years 1873-1876, Zoology, 30(51) Report on the Scientific Results of the Voyage of H.M.S. Challenger30. 1889;30:893. [Google Scholar]
  • Smith C. R, De Leo F, Bernadino A, Sweetman A, Arbizu P. Abyssal food limitation, ecosystem structure and climate change. http://dx.doi.org/10.1016/j.tree.2008.05.002. Trends in Ecology & Evolution. 2008;23(9):518–528. doi: 10.1016/j.tree.2008.05.002. [PubMed] [CrossRef] [Google Scholar]
  • Smith C. R., Dahlgren T. G., Glover A. G., Gooday A., Kurras G., Martinez-Arbizu P., Shulse C., Spickermann R., Sweetman A. K., Vetter E. Abyssal Baseline Study (ABYSSLINE) Cruise Report. Seafloor Investigations Report. 2013;2013-1304-051J-SRDL-AB01:1–160. [Google Scholar]
  • Smith C. R, Dahlgren T. G, Drazen J, Glover A. G, Gooday A, Kurras G, Martinez-Arbizu P, Shulse C, Spickermann R, Sweetman A. K, Vetter E. Abyssal Baseline Study (ABYSSLINE) Cruise Report: Abyssal Baseline (AB01) – SRD UK-1 Site Oct 3 – 27, 2013 R/V Melville 13.8⁰N 116.6⁰W. Seafloor Investigations Report. 2013;2013-1304-051J-SRDL-AB01:1–160. [Google Scholar]
  • Smith Vincent, Georgiev Teodor, Stoev Pavel, Biserkov Jordan, Miller Jeremy, Livermore Laurence, Baker Edward, Mietchen Daniel, Couvreur Thomas, Mueller Gregory, Dikow Torsten, Helgen Kristofer M., Frank Jiři, Agosti Donat, Roberts David, Penev Lyubomir. Beyond dead trees: integrating the scientific process in the Biodiversity Data Journal. http://dx.doi.org/10.3897/bdj.1.e995. Biodiversity Data Journal. 2013;1:e995. doi: 10.3897/bdj.1.e995. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Théel H. Report on the Holothuroidea dredged by H.M.S. 'Challenger' during the years 1873-76. 1882;4:176pp. [Google Scholar]
  • Wedding L M, Friedlander A M, Kittinger J N, Watling L, Gaines S D, Bennett M, Hardy S M, Smith C R. From principles to practice: a spatial approach to systematic conservation planning in the deep sea. http://rspb.royalsocietypublishing.org/cgi/doi/10.1098/rspb.2013.1684. Proceedings Of The Royal Society B-Biological Sciences. 2013;280(1773):20131684–20131684. doi: 10.1126/science.1223009. English. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wedding L. M, Reiter S. M, Smith C. R, Gjerde K. M, Kittinger J. N, Friedlander A. M, Gaines S. D, Clark M. R, Thurnherr A. M, Hardy S. M. Managing mining of the deep seabed. Science. 2015;349(6244):144–145. doi: 10.1126/science.aac6647. [PubMed] [CrossRef] [Google Scholar]
Articles from Biodiversity Data Journal are provided here courtesy of Pensoft Publishers
-