J Obes Metab Syndr 2018; 27(2): 102-109
Published online June 30, 2018 https://doi.org/10.7570/jomes.2018.27.2.102
Copyright © Korean Society for the Study of Obesity.
Hyunjung Choi, Chu-Sook Kim, and Rina Yu *
Department of Food Science and Nutrition, University of Ulsan, Ulsan, Korea
Correspondence to:
Rina Yu,
https://orcid.org/0000-0002-1965-3891,
Department of Food Science and Nutrition, University of Ulsan, 93 Daehak-ro, Nam-gu, Ulsan 44610, Korea,
Tel: +82-52-259-2372,
Fax: +82-52-259-1698,
E-mail: rinayu@ulsan.ac.kr
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Uncoupling protein 1 (UCP1) plays an important role in increasing energy expenditure; thus, it is being considered as a new target for preventing obesity and metabolic complications. In this study, we investigated the effect of quercetin, a naturally occurring flavonoid, on UCP1 expression in white/brown adipose tissues (WAT/BAT). Mice were fed a high-fat diet (HFD) supplemented with or without dietary quercetin for 9 weeks, and 3T3-L1 adipocytes were treated with quercetin. Expression of UCP1 and other thermogenic genes/proteins was measured by real-time polymerase chain reaction and/or Western blotting. Dietary quercetin supplementation increased the level of UCP1 in both WAT and/or BAT of HFD-fed obese mice, which was accompanied by upregulated mRNA levels of thermogenesis-related genes. Quercetin supplementation enhanced the plasma norepinephrine level and tended to upregulate These findings suggest that quercetin upregulates UCP1, implying increased WAT browning and BAT activity, via activation of the AMPK/PPARγ pathway through sympathetic stimulation. Quercetin may be useful for preventing obesity and metabolic complications.Background
Methods
Results
Conclusion
Keywords: Obesity, Adipose tissue, Uncoupling protein 1, Quercetin
Obesity increases risks of metabolic complications such as insulin resistance and type 2 diabetes. Adipose tissues play an important role in energy storage, energy dissipation, and endocrine function, and an excessive accumulation of fat in adipose tissue, which results from an imbalance between energy intake and energy expenditure, causes chronic low-grade inflammation and hence is thought to be a major contributor to the pathogenesis of obesity.1,2
Adipose tissues are classified into two different types: white adipose tissue (WAT) and brown adipose tissue (BAT). The former is the primary site for storage of excess fat, and the latter is responsible for non-shivering thermogenesis, in which energy is dissipated as heat. There is growing evidence that white adipocytes can acquire a brown-like adipocyte phenotype, known as browning of WAT, such as that of beige/brite adipocytes in WAT depots, in response to different stimuli including beta-adrenergic stimulation and chronic exposure to cold.3 Hence, it is conceivable that controlling BAT activity and browning of WAT may protect against obesity and its related complications. Uncoupling protein 1 (UCP1), a thermogenic factor, is highly expressed in BAT and is also expressed during beige adipocyte development (browning) in WAT.3 UCP1 is located in the mitochondrial inner membrane; it uncouples oxidative phosphorylation from adenosin triphosphate synthesis, thereby dissipating energy by triglyceride hydrolysis, which leads to increased energy expenditure.4 The induction of UCP1 accompanied by thermogenesis has been recognized as a new strategy for preventing obesity and metabolic complications.5 With respect to this, food-derived thermogenic activators capable of inducing UCP1, which facilitates WAT browning and/or increases BAT activity, may protect against obesity and metabolic complications.
Quercetin is a polyphenolic flavonoid that is present in many fruits and vegetables, including onions, broccoli, tomatoes, and apples. We and others have shown that it elicits protective effects against obesity-induced peripheral/central inflammation and signs of metabolic dysregulation such as insulin resistance, hyperlipidemia, muscle atrophy, and fatty liver.6–9 Some plant-derived polyphenolic compounds such as curcumin and resveratrol, which have anti-obesity properties, increase UCP1 expression in BAT, WAT, and skeletal muscle of mice fed a high-fat diet (HFD)10,11, indicating that their anti-obesity properties are associated with their thermogenic action. Quercetin has been shown to modulate mitochondrial function12, which is important for the thermogenic response. However, quercetin’s potential to act as a thermogenic factor by inducing browning of WAT and/or activation of BAT, as well as the underlying mechanisms of the action, have not been thoroughly investigated.
In this study, we demonstrate that quercetin induces UCP1 expression, implicating WAT browning and BAT activation. Quercetin-induced upregulation of UCP1 was associated with activation of the AMP-activated protein kinase (AMPK)/peroxisome proliferator-activated receptor gamma (PPARγ) pathway through sympathetic stimulation.
Quercetin was purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies used for Western blotting were anti-UCP1 (Abcam, Cambridge, UK), anti-PPARγ coactivator 1-alpha (PGC1α, Abcam), anti-PPARγ (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-cyclic AMP (cAMP)-dependent protein kinase (PKA, Abcam), anti-phospho-AMPKα (Cell Signaling Technology, Danvers, MA, USA), and anti-AMPKα (Cell Signaling Technology). Anti-α-tubulin (Abcam) was used as a control for protein loading.
Male C57BL/6 mice were purchased from Orient Bio (Busan, Korea) at 8 weeks old. Experimental animals were housed in a pathogen-free barrier facility that was maintained at 22°C±2°C at 55%–60% humidity with a 12-hour light/12-hour dark cycle and free access to autoclaved water. After adapting for 1 week, mice were randomly divided into two groups: one group was fed an HFD (60% of calories from fat; Research Diets, New Brunswick, NJ, USA; n=6) and the other, an HFD supplemented with 0.05% (w/w) quercetin (HFD+0.05% Que, ≥95% purity; n=6) for 9 weeks. Body weights and food intakes were measured weekly. At the end of 9 weeks of treatment, mice were sacrificed by carbon dioxide anesthesia. Inguinal WAT and BAT were rapidly isolated and weighed. One side of adipose tissue from each mouse was stored at −80°C until further analyses. A middle portion of the other side was fixed in 10% formaldehyde for sectioning and staining. All animal experiments were approved by the University of Ulsan Animal Care and Use Committee (No. LNY-15-010).
Tissues fixed in 10% formaldehyde were sectioned (5 μm thick) after being paraffin embedded. Routine hematoxylin-eosin staining of adipose tissue sections was performed. Immunohistochemistry for the UCP1 was performed on deparaffinized sections. For antigen retrieval, slides were submerged in 0.01 M sodium citrate (pH 6.0) and heated to 100°C for 20 minutes. To remove intrinsic peroxidase, slides were incubated with 3% H202 for 5 minutes, and to prevent nonspecific reactions, slides were incubated with 1.5% normal blocking serum for 20 minutes. This step was followed by incubation with rabbit polyclonal anti-UCP1 primary antibody (Abcam) diluted 1:200 in 1.5% normal blocking serum (Vector, Burlingame, CA, USA) overnight at room temperature. Then, secondary antibody incubation and detection were performed for 30 minutes with biotinylated goat anti-rabbit antibody (1:200, Vector). At the end of each step, slides were washed with phosphate-buffered saline (pH 7.4) for 5 minutes. Signal was detected with a Vector kit (Vector). UCP1-positive areas in random fields in each section were determined by examination of stained areas under a microscope (Carl Zeiss, Gottingen, Germany).
Dulbecco’s modified Eagle’s medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (Biological Industries USA, Cromwell, CT, USA) and 100 μg/mL penicillin-streptomycin (Gibco) was used to culture 3T3-L1 preadipocytes (ATCC, Manassas, VA, USA) at 37°C in a 5% CO2 incubator. Confluent 3T3-L1 preadipocytes (5×104 cell/well) in 24-well plates (day 0) were maintained in differentiation induction medium containing 0.5 mM 1-methyl-3-isobutylxanthine (Sigma-Aldrich), 0.25 μM dexamethasone (Sigma-Aldrich), 10 μM quercetin, and 10 μg/mL insulin (Sigma-Aldrich) for 40–42 hours. Next, cells were maintained in differentiation maturation medium containing 0.5 mM 1-methyl-3-isobutylxanthine, 5 μg/mL insulin, and 10 μM quercetin (Jena Bioscience, Jena, Germany) for 6 days, and the culture medium was replaced with fresh medium every 2 days. 3T3-L1 adipocytes treated with 10 μM quercetin showed no significant difference in viability compared with control cells. To examine the effects of inhibition of PPARγ, cells were pretreated with 20 μM GW9662 (PPARγ inhibitor, Sigma-Aldrich) for 1 hour.
Equal amounts of cell samples were dissolved in lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 1 mM EDTA, 50 mM NaF, 10 mM Na4P2O7, 1% IGEPAL, 2 mM Na3VO4, 0.25% protease inhibitor cocktail, and 1% phosphatase inhibitor cocktail), separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and transferred onto nitrocellulose membranes. Membranes were blocked and incubated with different antibodies, followed by incubation with secondary antibodies. Membrane proteins were visualized using an enhanced chemiluminescent substrate kit (PerkinElmer, Waltham, MA, USA). The intensity of the protein bands was quantified by densitometry using ImageJ software (National Institutes of Health, Bethesda, MA, USA).
Total RNA was extracted with the TRIzol method (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions, and then reverse-transcribed into cDNA using M-MLV reverse transcriptase (Promega, Madison, WI, USA). For target gene expression analysis, cDNA was amplified using a SYBR Premix Ex Taq kit (Takara Bio, Foster City, CA, USA) and a Thermal Cycler Dice (Takara Bio, Kusatsu, Japan). Results were analyzed with Real Time System TP800 software (Takara Bio), and all values for genes were normalized to values for the housekeeping gene,
All data are given as mean±standard error of the mean. The significance of differences between the two groups was assessed by Student
Using HFD-fed obese mice, we first examined whether dietary quercetin supplementation induced expression of UCP1 and browning of WAT
The UCP1-mediated thermogenic response is regulated primarily by the sympathetic nervous system (SNS) through the binding of norepinephrine to the β3-adrenergic receptor (β3AR). We examined whether quercetin affects norepinephrine release and the expression of its receptor. As shown in Fig. 2A, levels of plasma norepinephrine in quercetin-supplemented HFD-fed obese mice were significantly higher than in HFD-fed obese controls. Additionally, we observed that quercetin supplementation tended to upregulate levels of
PKA, which is a downstream target of β3AR signaling, has been reported to activate AMPK, inducing UCP1 expression and thus browning of WAT.13 We examined the effect of quercetin supplementation on PKA expression and AMPK activation in the WAT of HFD-fed obese mice. Expression of PKA protein in WAT was significantly increased in quercetin-supplemented HFD-fed mice compared to HFD-fed controls (Fig. 2C). In addition, we observed that phosphorylation of AMPK in the WAT of HFD-fed obese mice was also increased by quercetin supplementation (Fig. 2D).
BAT is a specialized adipose tissue that expresses UCP1, dissipating chemical energy to produce heat in non-shivering thermogenesis. Activation of BAT is known to lead to an increase in energy expenditure. To examine the effect of quercetin supplementation on BAT activity, we measured UCP1 expression in the BAT of HFD-fed obese mice. BAT from quercetin-supplemented HFD-fed obese mice contained small brown adipocytes with multiple small lipid droplets and a centralized nucleus surrounded by a clear cytoplasm, compared to HFD-fed controls (Fig. 3A). In addition, there was stronger immunostaining of UCP1-positive areas in quercetin-supplemented HFD-fed mice than control mice (Fig. 3B). Consistent with this, Western blotting showed that expression of the UCP1 protein in BAT was significantly upregulated by quercetin supplementation (Fig. 3B).
Upregulation of UCP1 mRNA/protein, which is closely associated with increased adaptive thermogenic activity and energy expenditure14, is widely used as a marker not only of BAT activity, but also of a brown-like phenotype, such as that of beige/brite adipocytes.15 Studies have shown that several flavonoids have thermogenic activity by inducing UCP1 in BAT and WAT.10,11 In this study, we found that quercetin supplementation enhanced the expression of a core set of thermogenic genes (i.e.,
It is known that the SNS, which innervates BAT, regulates thermogenic activity by increasing norepinephrine release from BAT SNS terminals. Norepinephrine acts on β3AR expressed in brown adipocytes, activating mitochondrial UCP1, which is responsible for increased BAT thermogenesis. β-adrenergic stimulation can enhance not only BAT activation, but also WAT browning17, and may therefore protect against obesity and metabolic complications.18,19 Indeed, we found that quercetin supplementation increased norepinephrine levels in the plasma of HFD-fed obese mice. In addition, quercetin upregulated
Expression of UCP1 is directly controlled by PPARγ, a ligand-activated transcription factor of the nuclear receptor superfamily, by interaction with its coactivator PGC1α, indicating that PPARγ and PGC1α are essential for promoting the browning of WAT and the development of BAT.22–24 In this study, we observed that quercetin upregulated the expression of PPARγ and PGC1α proteins in WAT, indicating that quercetin-induced UCP1 induction may be attributed to quercetin’s ability to upregulate PPARγ and PGC1α. Of note, activation of AMPK is known to increase the expression of mitochondrial biogenesis signals via PGC1α expression.25 We found that quercetin enhanced the phosphorylation of AMPK in the WAT of HFD-fed obese mice, and this was accompanied by upregulation of the mitochondria-related genes
In summary, quercetin supplementation increased the expression of UCP1 protein in both WAT and BAT in HFD-fed obese mice, and this was accompanied by upregulation of mitochondrial thermogenic genes. Quercetin supplementation enhanced the plasma level of norepinephrine and the mRNA level of its receptor
The authors declare no conflict of interest.
This work was supported by the SRC program (Center for Food & Nutritional Genomics Research: No. 2015R1A5A6001906) of the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology.
Sequences of primers used for quantitative real-time polymerase chain reaction
Gene | Forward primer | Reverse primer |
---|---|---|
CTGTCTCAATGTCAAAGCCACGA | TGTGCAGCATAGGACATAAACCTCA | |
GACCTTGCCACAGGCAGGTAA | CGCCTGCTCCATGAACACTC | |
CCGTAAATCTGCGGGATGATG | CAGTTTCGTTCGACCTGCGTAA | |
CCTAGCCCTGAGCGATACTGTGA | ACAGACAATGGCTGGAATGGTG | |
TCAGGAGCAGCAGGCACTACA | CTGAGCTCCGAGTCCTTGAACAC | |
GGCCGTGAAGCCATAAAGCTA | AAAGGCTCCTGTTGAACCAAGAC | |
ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG | |
AAGGGCCGTGAAGATCCAG | TGTTGCATCCATAGCCGTTG | |
TTCCGATAACGAACGAGACTCT | TGGCTGAACGCCACTTGTC |
Online ISSN : 2508-7576Print ISSN : 2508-6235
© Korean Society for the Study of Obesity.
Room 1010, Renaissance Tower Bldg., 14, Mallijae-ro, Mapo-gu, Seoul 04195, Korea.
Tel: +82-2-364-0886 Fax: +82-2-364-0883 E-mail: journal@jomes.org
Powered by INFOrang Co., Ltd